Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA040304 Similarity: 0.952 Similarity: 0.950 Similarity: 0.950
UTR: 5HSAA040304
Gene: FDPS_1
MFE: -62.177
ENS: 0.767
Length: 159.
Predicted Ligands:
FMN - 8/20
cobalamin - 7/20
SAM - 3/20
 RS: URS0000C39014_1736488
MFE: -58.945
Ligand: FMN
Species: Nocardioides sp. Root190 FMN riboswitch (RFN element)
 RS: URS00023167D3_1834515
MFE: -68.712
Ligand: cobalamin
Species: Frankia sp. EUN1h Cobalamin riboswitch
 RS: URS0002324F76_499555
MFE: -53.605
Ligand: cobalamin
Species: Dietzia timorensis Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA040304 URS0000C39014_1736488 URS00023167D3_1834515 URS0002324F76_499555
Length 159. 159. 157. 158.
Similarity - 0.952 0.950 0.950
Ensemble Norm 0.767 - - -
MFE -62.177 -58.945 -68.712 -53.605
Ligands - FMN cobalamin cobalamin
Gene FDPS - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 12.005 32.003 9.005
Length SE - 0. 4. 1.
Lev Distance - 59. 47. 62.
UBS 10. 9. 8. 9.
BS 4. 5. 3. 5.
ILL 3. 3. 3. 2.
ILR 2. 2. 2. 2.
H 3. 3. 4. 4.
BL 6. 5. 1. 5.
BR 1. 4. 2. 3.
UN 0.063 0.132 0.115 0.133

Sequences

Field Description
UTR seq + 25 uguggggagagcgggaacuacucgacccacagagccgaucgcggagcggauucugcuuuuaggaguacccgccaacaagcgggaccgagcaggaauccguaucugggaacagagcccuuugcuccucccucagaATGGATTCATCCCTTACCCGCCGGG
UTR dot + 25 ((((((..(((.((…)).)))..))))))…(((…((((((.((((.((((((….(.((.(((((……))))))))))))))((((((((.((((((….((((…..))))….))))))))))))))))))))…))))))).
RS 1 seq UCGCGUGCUCUGGGGUCGGUGAAAAUCCGAGCCGGCGGUGAAUGAUCCGAAGCGUCCUCGCUUCGCUCACAAGUCCGCGACCCGAUCACAUCCAGUGAUCGGUUGACCAGGUGGAACUCCUGGACCGACGGUCAAAGUCCGGAUGGGAAGUGCACGCAA
RS 1 dot ((((.((((…((.((((…….)))).))))))))))……….((((…((((((.(……(((((.(((((((((((…..))))))))((((((.(..((..(….)..))..))))))).))))))))).)))))).))))..
RS 2 seq GGGCCAUUGACAGGCUCUGGUGCUCCCCGCACACUUCGAACGCGAUCUGUAGGUGGAAGCCGGUGCGAGUCCGGCACGGUCGCGCCACUGUGAUCAAGCCUUCCCGCCCGUCCGGCGGUCGCUUGAGAGUCAGACCCACCUGCGGGUCCGGUCCGAA
RS 2 dot (((((…….)))))..((((…..))))…(((.((..(((((((((((((…..(((((((..(((…)))))))))).((((..((((((….(((((…..)))))..))))))..).)))..)))))))))))))..)).))).
RS 3 seq CGACCACGAUGUGGACGCGGCCCGCGGCACCGAGCGCCAUGAGAGCGCAAGAGGGAACCUGGUGCGAAUCCAGGACUGUCCCGCAACGGUAUGGGGCGAAUAUGCGAACGAAGAUCGCCGCCUCGAGUCCGAUUACCUGCCGAUUGUGCUGGGUGCGC
RS 3 dot …((((…)))).((((…))))(((((.(((((…((..(.(((.(.((((.(((((…….)))))….)))).)..(((..(((((((…..((((…….)))))))))).)..)))……))))..))))))).)))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table