Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA040628 Similarity: 0.974 Similarity: 0.970 Similarity: 0.970
UTR: 5HSAA040628
Gene: FGF14
MFE: -25.837
ENS: 0.991
Length: 121.
Predicted Ligands:
molybdenum - 12/20
Mn2+ - 4/20
FMN - 2/20
 RS: URS0000C40A86_1869311
MFE: -43.052
Ligand: molybdenum
Species: Desulfuromonadales bacterium C00003096 Moco (molybdenum cofactor) riboswitch
 RS: URS0000AB6B72_465515
MFE: -42.978
Ligand: methionine
Species: Micrococcus luteus NCTC 2665 S-adenosyl methionine (SAM) riboswitch,
 RS: URS0000D8A072_1797678
MFE: -38.287
Ligand: molybdenum
Species: Clostridiales bacterium GWC2_40_7 Moco (molybdenum cofactor) riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA040628 URS0000C40A86_1869311 URS0000AB6B72_465515 URS0000D8A072_1797678
Length 121. 120. 120. 120.
Similarity - 0.974 0.970 0.970
Ensemble Norm 0.991 - - -
MFE -25.837 -43.052 -42.978 -38.287
Ligands - molybdenum methionine molybdenum
Gene FGF14 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 1.002 9.001 4.
Length SE - 1. 1. 1.
Lev Distance - 33. 36. 38.
UBS 7. 6. 9. 7.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 3.
ILR 2. 2. 3. 3.
H 3. 3. 3. 3.
BL 0. 0. 2. 1.
BR 1. 1. 1. 0.
UN 0.198 0.158 0.175 0.

Sequences

Field Description
UTR seq + 25 cuggccgaaaacaaacaaucacugagaagucucaaagaaauauaccacgugaggggaaaaaacugggagaagauccggaauauuaucguuuuuccuATGGCCGCGGCCATCGCTAGCGGCT
UTR dot + 25 ……………(..((((((((….))))…………..))))..)……..(((((((((…(((…….)))))))))))).(((((((((….))).))))))
RS 1 seq AACCUUAAUCAUCUCCGAGCCUGCCGACCUAAAGAUAACAGCUCCAAGGUCGAGGGCCUACGGGUCUCGCUGGAAACGGCGGGGCCUCCCGUAUUGGAAAGGAGAGUUCUUCCUCGCCGA
RS 1 dot ………………((((..((((((…………….)))))).)))).((((((((((((((….))))))))…))))))((((..(((((…..)))))..))))
RS 2 seq AAUCACGAGUCCCCGUCAUUCACGGCCCUGGCCGGCGGGACGGCAACCCUCUCACGCAGUAGUGGGGUGCUCCAGGUGAUGAUUCGGCCCCUCGGACACCCCGGCGGGCAAGUACCGCGU
RS 2 dot ……(((…(((((.((..((((….))))..)))))))…..)))…………((((((.(((((((((….)))…))).))))))))).((((…….))))..
RS 3 seq AUUUAUAUAUUGCUCCGAGCCGGGAAAGCCUAAGACUUGAUGUUAUGGUACCCCGGCCGAUAGGGUAGGUCUGGAAACGGGUCUGCCUCCCAUGUGGAAAGGAGAACCAAUCUAUGUUGA
RS 3 dot ……………((.((((((…(((…(((…..)))..)))..))))))))…(((((((((((….)))))))))))…(((((((..((….))..)))))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table