Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA040644 Similarity: 0.986 Similarity: 0.982 Similarity: 0.981
UTR: 5HSAA040644
Gene: FGF6
MFE: -31.070
ENS: 0.885
Length: 69.
Predicted Ligands:
homocysteine - 6/20
cobalamin - 4/20
fluoride - 4/20
 RS: URS0000AB1A13_257314
MFE: -16.931
Ligand: SAM
Species: Lactobacillus johnsonii NCC 533 SMK box translational riboswitch (SAM-III)
 RS: URS0000D6B018_12908
MFE: -23.317
Ligand: Ni/Co
Species: unclassified sequences NiCo riboswitch
 RS: URS0000AB2BC5_324831
MFE: -15.281
Ligand: SAM
Species: Lactobacillus gasseri ATCC 33323 SMK box translational riboswitch (SAM-III)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA040644 URS0000AB1A13_257314 URS0000D6B018_12908 URS0000AB2BC5_324831
Length 69. 71. 69. 72.
Similarity - 0.986 0.982 0.981
Ensemble Norm 0.885 - - -
MFE -31.070 -16.931 -23.317 -15.281
Ligands - SAM Ni/Co SAM
Gene FGF6 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4. 2.041 4.
Length SE - 4. 0. 9.
Lev Distance - 13. 24. 15.
UBS 4. 5. 4. 5.
BS 0. 0. 0. 0.
ILL 1. 2. 1. 2.
ILR 1. 2. 0. 2.
H 2. 2. 2. 2.
BL 1. 0. 1. 0.
BR 0. 0. 1. 0.
UN 0.043 0.042 0.246 0.042

Sequences

Field Description
UTR seq + 25 uuuagggccauuaauucugaccacgugccugagaggcaagguggATGGCCCTGGGACAGAAACTGTTCA
UTR dot + 25 ..(((((((((………((((.(((((…)))))..)))))))))))))((((((…)))))).
RS 1 seq UUCGGUUAAGGUCCCGAAAGGAUUCGUUUUUAACGAAGAUGCCUUGUAACCGAAAGAUGGGGGACUCUAUG
RS 1 dot ((((((((((((…….(..((((((…))))))..)))))..))))))))..(((((….))))).
RS 2 seq UAUAUGCGUAAAGAACAGGCCAUGCUCUAUGGCCGGGCGCAAGCAGUAGGCGCAGCCUGCGGGACUACA
RS 2 dot ….(((((……(.(((((((…))))))).))))))….((((((…))))))………
RS 3 seq UUCGGUUAAGGUCCCGAAAGGAUUCGCUUUUUAACGAAGAUGCCUUGUAACCGAAAGAUGGGGGACUCUAUG
RS 3 dot ((((((((((((…….(..((((……..))))..)))))..))))))))..(((((….))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table