Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA040838 Similarity: 0.955 Similarity: 0.952 Similarity: 0.948
UTR: 5HSAA040838
Gene: FGGY
MFE: -61.245
ENS: 0.881
Length: 161.
Predicted Ligands:
FMN - 11/20
glucosamine - 4/20
Mg2+ - 2/20
 RS: URS0000AB7196_309801
MFE: -68.715
Ligand: glucosamine
Species: Thermomicrobium roseum DSM 5159 glmS glucosamine-6-phosphate activated ribozyme
 RS: URS0000AB7DF9_626418
MFE: -58.152
Ligand: FMN
Species: Burkholderia glumae BGR1 FMN riboswitch (RFN element)
 RS: URS0000D7D293_1437360
MFE: -52.562
Ligand: FMN
Species: Bradyrhizobium erythrophlei FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA040838 URS0000AB7196_309801 URS0000AB7DF9_626418 URS0000D7D293_1437360
Length 161. 160. 158. 159.
Similarity - 0.955 0.952 0.948
Ensemble Norm 0.881 - - -
MFE -61.245 -68.715 -58.152 -52.562
Ligands - glucosamine FMN FMN
Gene FGGY - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11.003 6. 16.
Length SE - 1. 9. 4.
Lev Distance - 52. 48. 53.
UBS 15. 14. 15. 14.
BS 0. 0. 0. 0.
ILL 2. 3. 1. 2.
ILR 1. 3. 3. 3.
H 5. 5. 4. 4.
BL 5. 6. 5. 6.
BR 8. 6. 8. 5.
UN 0.068 0.119 0.089 0.088

Sequences

Field Description
UTR seq + 25 gaucgcgcgcaaggcggggcuguagccgccccgggaccgcccugcucaggcgccgugggguucggcgcggcuacgugcagaauccgucuagcuaaaauguaauuucagauuggacaaguacuguggaggaacugcaATGGGGATCAGCAAAGACCCGATTT
UTR dot + 25 …(((((((..((((((((.((..(((…))).)).))))))).)..)))).)))((((((.(((((….))))).))))))((((((((.((((…)))).)).))))))…….((((…..))))(((.(((.((……))))).))).
RS 1 seq UCGGAUGGAGUAGCGCCAGGACUCGUCGCGGGGGAGACGAGUCGACGAGGUGGAGGUCGAUCGAGGCAUUCGGCGGAUGGCCUCCCGGCUCGCACGGUCGUGACGGUGAGAGCAAAACCGGUGGGUAACCGCCGGGACAAAGGCUCACCGAUGUGCCCCG
RS 1 dot …(((.((.(..((((..((((((((.(….).))))))))…..))))..).)).)))(((((..((….))..)))))…((((.(((.((….)).))).))))….(((((((….)))))))……(((.((….)).)))…
RS 2 seq GAACGUUCUCAGGGCGGGGCGAAAUUCCCCACCGGCGGUAAUCAUGCUCCGCGCAUGUAGCCCGCGAACAGCUCGCCUCGGGUGCGCCCGACGCGAUGCCUGCCGACCCGGUGCGAUUCCGGGGCCGACGGUCAUAGUCCGGAUGAGAGAGAGCGGGG
RS 2 dot …(((.(((((.((((((((..(((((((…)).)).)))..)))))))).).)).))…)))….((((((.(((((….))))).)))).))(((.((.(((((…….)))))..)).)))……((((…………)))).
RS 3 seq CGAUGUUCUCAGGGCGGGGUGAAAAUCCCCACCGGCGGUAAGGGUGACGUAGCCCAAGCCCGCGAGCGCCUUCUUGUCUGGGAAACCAGAGAAAAAGGGUCAGCAGAUUCGGUGUGAAUCCGAAGCCGACGGUUAAAGUCCGGAUGAAAGAGAACGGUU
RS 3 dot …(((((.(.((((.((((…..((((((((…)))..))).))….))))..))))).)))))((((.((.(((((….))))).)).))))(((.((…(((((…….))))))).)))………(((…………)))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table