Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA040842 Similarity: 0.979 Similarity: 0.979 Similarity: 0.978
UTR: 5HSAA040842
Gene: FGGY_0
MFE: -29.315
ENS: 0.964
Length: 95.
Predicted Ligands:
SAM - 12/20
TPP - 4/20
cobalamin - 1/20
 RS: URS0000AB2A25_1262738
MFE: -19.702
Ligand: TPP
Species: Bacteroides sp. CAG:20 TPP riboswitch (THI element)
 RS: URS0000D93902_1897039
MFE: -19.702
Ligand: TPP
Species: Bacteroidales bacterium 43_8 TPP riboswitch (THI element)
 RS: URS0000D6B2CE_12908
MFE: -19.627
Ligand: SAM
Species: unclassified sequences SAM-I/IV variant riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA040842 URS0000AB2A25_1262738 URS0000D93902_1897039 URS0000D6B2CE_12908
Length 95. 93. 93. 95.
Similarity - 0.979 0.979 0.978
Ensemble Norm 0.964 - - -
MFE -29.315 -19.702 -19.702 -19.627
Ligands - TPP TPP SAM
Gene FGGY - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.001 6.001 3.009
Length SE - 4. 4. 0.
Lev Distance - 21. 21. 28.
UBS 8. 7. 7. 7.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 1.
ILR 1. 1. 1. 1.
H 3. 3. 3. 3.
BL 2. 3. 3. 3.
BR 3. 1. 1. 2.
UN 0.168 0.194 0.194 0.263

Sequences

Field Description
UTR seq + 25 cugacacacacacccaucaggggcugcggagaguccgccuggguaagcuccgcaagguggaggaacugcaATGGGGATCAGCAAAGACCCGATTT
UTR dot + 25 …………(((….)))…((((….((((((((((……)).)).))))))….))))(((.(((.((……))))).))).
RS 1 seq UCACAAACAAAGGGGUGCCUAAAAGCGGCUGAGAUUAUACCCUAUGAACCUGAUACGGAUAAUGCCGGCGCAGGAAUUGUUCAUAGUUCUAUC
RS 1 dot ……….(((….)))….((.((((..(((((.((.(((…….))).)))))))..)))))).(((((((….)))))))…
RS 2 seq UUGCAAACAAAGGGGUGCCUAAAAGCGGCUGAGAUUAUACCCUAUGAACCUGAUACGGAUAAUGCCGGCGCAGGAAUUGUUCAUAGUUCUAUC
RS 2 dot ……….(((….)))….((.((((..(((((.((.(((…….))).)))))))..)))))).(((((((….)))))))…
RS 3 seq UUACGACAUCAAGAACGCAUAUGCGUACCAACCGACUAUCUCGAAGCACGGUGGUUUAGAAUGUGGGUAGCUCUACCAAAAAUUCGAGCAAUCAG
RS 3 dot …………..((((….))))….(((.((..(((.(((.((…)).))))))..)).))).((((…………))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table