Detected as a riboswitch by 10 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA040850 Similarity: 0.965 Similarity: 0.964 Similarity: 0.964
UTR: 5HSAA040850
Gene: FGGY_1
MFE: -36.060
ENS: 0.870
Length: 138.
Predicted Ligands:
cobalamin - 14/20
molybdenum - 3/20
zmp-ztp - 1/20
 RS: URS000232FCDB_309801
MFE: -56.983
Ligand: cobalamin
Species: Thermomicrobium roseum DSM 5159 Cobalamin riboswitch
 RS: URS0000C58941_1609106
MFE: -66.399
Ligand: cobalamin
Species: Streptomyces sp. NRRL B-1568 Cobalamin riboswitch
 RS: URS0002327B0E_1736408
MFE: -64.569
Ligand: cobalamin
Species: Nocardioides sp. Soil774 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA040850 URS000232FCDB_309801 URS0000C58941_1609106 URS0002327B0E_1736408
Length 138. 136. 137. 139.
Similarity - 0.965 0.964 0.964
Ensemble Norm 0.870 - - -
MFE -36.060 -56.983 -66.399 -64.569
Ligands - cobalamin cobalamin cobalamin
Gene FGGY - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10. 12. 7.010
Length SE - 4. 1. 1.
Lev Distance - 38. 42. 44.
UBS 8. 10. 11. 8.
BS 0. 0. 0. 2.
ILL 2. 4. 3. 3.
ILR 2. 2. 3. 2.
H 2. 2. 2. 3.
BL 2. 3. 2. 2.
BR 2. 3. 3. 1.
UN 0.058 0.051 0.073 0.158

Sequences

Field Description
UTR seq + 25 aaauuuugcaugaucgcauggagaauggauuuuguugcuuuaucugauauuguccucagcuccuccugaauuugccgagaucuuacagcagucaguaagguggaggaacugcaATGGGGATCAGCAAAGACCCGATTT
UTR dot + 25 ..(((((.((((….)))).)))))((.((((((((…………..(((((((((((((((………….(((((((……..)))))))))))))…))..))))))))))))))).))……
RS 1 seq UGCGAGCAGGAGCGCAGAAGUUCGUUCUGCUCGUCCACACGGGGGAACACCGGUGAAAGUCCGGGGCUGUGCCGCAACUGUGACGUCGCACCAGUCGGUGCGACGAAGCCAGGUCUACCGUCGCCGCCGUGUCCGA
RS 1 dot .((((((((((((……))))…))))))))..((((((.((…..((((…((.((..((((.(………….(((((((((….)))))))))))))).)).))))))…)).))))))….
RS 2 seq AGAGGAAGCCGGUGCGAGUCCGGCGCGGUCCCGCCACUGUCACCGGGGAGCGUGCCCCCACUCGGCACAGGCCACGGCCCGCGCAGUCGGCGGGCUGGAAGGCCGGGGGCGACGUCGAUCCGGGAGCCAGGAGACUC
RS 2 dot …….(((((…….)))))..((((((((…..((.(((((..((((((((((……….((((.((((((((…….))))))))…)))))))))).))).)..)))))))))..)).)))).
RS 3 seq UCGGGCCGCACCCGUCCGGGUCGGCACCACACACGCCCGAGGUGGGGAAAGCCGGUCCGAAUCCGGCGCUGACCCGCAACCGUAGGCACGGGAGAGAUCCCGUGCGAGCCGGAACACCCGCCUCGACGCGUCAUGACCA
RS 3 dot ..((((((.((((….)))))))).))….((((.(((((((((….(((((…….)))))..((..(((…..((..((((((((….))))))))..)))))..)))))))))))..))))……..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table