Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA041101 Similarity: 0.967 Similarity: 0.965 Similarity: 0.965
UTR: 5HSAA041101
Gene: FKBP15
MFE: -55.182
ENS: 0.968
Length: 143.
Predicted Ligands:
Mn2+ - 5/20
TPP - 5/20
cobalamin - 4/20
RS: URS0000C70440_1646498
MFE: -34.647
Ligand: Mn2+
Species: Acinetobacter sp. TTH0-4 yybP-ykoY manganese riboswitch
RS: URS0000C5A693_1341683
MFE: -31.147
Ligand: Mn2+
Species: Acinetobacter brisouii CIP 110357 yybP-ykoY manganese riboswitch
RS: URS0000C34E0B_1217655
MFE: -31.347
Ligand: Mn2+
Species: Acinetobacter guillouiae CIP 63.46 yybP-ykoY manganese riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA041101 URS0000C70440_1646498 URS0000C5A693_1341683 URS0000C34E0B_1217655
Length 143. 142. 144. 145.
Similarity - 0.967 0.965 0.965
Ensemble Norm 0.968 - - -
MFE -55.182 -34.647 -31.147 -31.347
Ligands - Mn2+ Mn2+ Mn2+
Gene FKBP15 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.003 3.003 5.003
Length SE - 1. 1. 4.
Lev Distance - 43. 45. 40.
UBS 10. 9. 10. 10.
BS 0. 0. 0. 0.
ILL 4. 4. 4. 4.
ILR 3. 3. 2. 5.
H 3. 3. 3. 3.
BL 2. 2. 1. 2.
BR 3. 2. 4. 2.
UN 0.098 0.155 0.153 0.152

Sequences

Field Description
UTR seq + 25 aguucgcccugccggaaagcagcacgccgccgcggcauuuuacgacgucggcggugacaggcccugggacucugggaauacccagcuuccuccccgcaacccggugaaagccaacgcaATGTTCGGTGCGGGGGACGAGGACG
UTR dot + 25 ………(.((((…((….((((((((((………..)).))))))))….)).)))).)..(((((….)))))((((.((((((((..((((…..((….))…..))))))))))))..))))…
RS 1 seq UUUCACUUCAUUGGGGAGUAGCCGCUUUUUACGCAAUGUAAAAAGGUGAUGGUCAACAUAAUUGCUCAACAGAGCAUGGUCAUCAUAGCAAAGAACCAAUUCAGCUUUUCACAAAGCUUUUUUUGUUGGCAAGACCUUUGAU
RS 1 dot ………..((..((.((.(..((((((((…..))))))))..).)).))..))….(((((….))))).((((….((((((((((…….((((((….))))))))))))))))….))))……
RS 2 seq ACACACUUCAUUGGGGAGUAGCCGCUAUUUACGUUUGUAAAUAGAUGAUGGUCAACAUACUUGUUCUGAACCGAACAUGGUCAUCAUAGCAAAGAACCAAAUGAGCUUUUCACCAAGCUUUCUUUUGUUGGCAAGACCUUUGAU
RS 2 dot ………..((..((.((..((((((((((….)))))))).)).)).))..))….(((((……))))).((((….(((((((((…….((((((……))))))))))).))))….))))……
RS 3 seq AAAAACUUCAUUGGGGAGUAGCCGCUUUUUACCUUGGGUAAAAAGGUGAUGGUCAACAUAAUUGCUUAAACAAGCAUGGUCAUCAUAGCAAAGAACCAAAAGAUCCUCUGAUCAUAGAUUUCUUUUUGUUGGCAAGACCUUUGAU
RS 3 dot ………..((..((.((.(..(((((((((…)))))))))..).)).))..))….(((((….))))).((((….((((((((((……((((….))))……)))))..)))))….))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table