Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA041102 Similarity: 0.968 Similarity: 0.966 Similarity: 0.965
UTR: 5HSAA041102
Gene: FKBP15_0
MFE: -55.182
ENS: 0.958
Length: 144.
Predicted Ligands:
TPP - 5/20
Mn2+ - 4/20
cobalamin - 4/20
 RS: URS0000C34E0B_1217655
MFE: -31.347
Ligand: Mn2+
Species: Acinetobacter guillouiae CIP 63.46 yybP-ykoY manganese riboswitch
 RS: URS0000C5A693_1341683
MFE: -31.147
Ligand: Mn2+
Species: Acinetobacter brisouii CIP 110357 yybP-ykoY manganese riboswitch
 RS: URS0000DA20FB_1279029
MFE: -59.418
Ligand: TPP
Species: Arthrobacter sp. 49Tsu3.1M3 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA041102 URS0000C34E0B_1217655 URS0000C5A693_1341683 URS0000DA20FB_1279029
Length 144. 145. 144. 144.
Similarity - 0.968 0.966 0.965
Ensemble Norm 0.958 - - -
MFE -55.182 -31.347 -31.147 -59.418
Ligands - Mn2+ Mn2+ TPP
Gene FKBP15 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.002 3.002 6.002
Length SE - 1. 0. 0.
Lev Distance - 40. 45. 44.
UBS 10. 10. 10. 10.
BS 0. 0. 0. 0.
ILL 4. 4. 4. 2.
ILR 3. 5. 2. 3.
H 3. 3. 3. 3.
BL 2. 2. 1. 3.
BR 3. 2. 4. 4.
UN 0.104 0.152 0.153 0.153

Sequences

Field Description
UTR seq + 25 gaguucgcccugccggaaagcagcacgccgccgcggcauuuuacgacgucggcggugacaggcccugggacucugggaauacccagcuuccuccccgcaacccggugaaagccaacgcaATGTTCGGTGCGGGGGACGAGGACG
UTR dot + 25 ……….(.((((…((….((((((((((………..)).))))))))….)).)))).)..(((((….)))))((((.((((((((..((((…..((….))…..))))))))))))..))))…
RS 1 seq AAAAACUUCAUUGGGGAGUAGCCGCUUUUUACCUUGGGUAAAAAGGUGAUGGUCAACAUAAUUGCUUAAACAAGCAUGGUCAUCAUAGCAAAGAACCAAAAGAUCCUCUGAUCAUAGAUUUCUUUUUGUUGGCAAGACCUUUGAU
RS 1 dot ………..((..((.((.(..(((((((((…)))))))))..).)).))..))….(((((….))))).((((….((((((((((……((((….))))……)))))..)))))….))))……
RS 2 seq ACACACUUCAUUGGGGAGUAGCCGCUAUUUACGUUUGUAAAUAGAUGAUGGUCAACAUACUUGUUCUGAACCGAACAUGGUCAUCAUAGCAAAGAACCAAAUGAGCUUUUCACCAAGCUUUCUUUUGUUGGCAAGACCUUUGAU
RS 2 dot ………..((..((.((..((((((((((….)))))))).)).)).))..))….(((((……))))).((((….(((((((((…….((((((……))))))))))).))))….))))……
RS 3 seq UAAUCACGACAGGGGAGCGCCGCCGUCGGGCAUCGCCGGAACAAUCCGGGGAAACCUUUGGUGGGCGCUGAGAGUGCGGACAGCCGCAGACCCUCGAACCUGAUCCGGUUAGUACCGGCGCAAGGGAGUCGAGUUCUCAGGGUG
RS 3 dot ……………((((((((((..(((..((.(((((….))))).))..))).)))))).))))…..(((((….))))).(((((.((((.(((((((((….)))))………)))).))))..))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table