Detected as a riboswitch by 10 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA041765 Similarity: 0.947 Similarity: 0.947 Similarity: 0.946
UTR: 5HSAA041765
Gene: FOXP1
MFE: -34.892
ENS: 0.860
Length: 179.
Predicted Ligands:
cobalamin - 11/20
lysine - 4/20
FMN - 2/20
 RS: URS0002318B7E_1897042
MFE: -42.948
Ligand: cobalamin
Species: Clostridiales bacterium 36_14 Cobalamin riboswitch
 RS: URS000232ED50_1895706
MFE: -46.205
Ligand: cobalamin
Species: Alphaproteobacteria bacterium 41-28 Cobalamin riboswitch
 RS: URS000231CDFA_1817874
MFE: -52.968
Ligand: cobalamin
Species: Candidatus Riflebacteria bacterium GWC2_50_8 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA041765 URS0002318B7E_1897042 URS000232ED50_1895706 URS000231CDFA_1817874
Length 179. 178. 180. 179.
Similarity - 0.947 0.947 0.946
Ensemble Norm 0.860 - - -
MFE -34.892 -42.948 -46.205 -52.968
Ligands - cobalamin cobalamin cobalamin
Gene FOXP1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 4. 5.004
Length SE - 1. 1. 0.
Lev Distance - 68. 68. 70.
UBS 12. 13. 11. 12.
BS 0. 0. 0. 0.
ILL 1. 2. 2. 3.
ILR 2. 2. 1. 2.
H 6. 7. 6. 5.
BL 3. 3. 3. 3.
BR 3. 3. 2. 3.
UN 0.190 0.169 0.206 0.128

Sequences

Field Description
UTR seq + 25 agucuagagacuuagaagcauuuauuaacagugaggcugcugaagguuuuuaauaacaaaauuacaaauacucuaucuaauugguaagacgugaccuuuugaggugacuauaacugaagauugcuuuacagaagccaaaaaagguuuuugagucATGATGCAAGAATCTGGGACTGAGA
UTR dot + 25 ….(((((((((((.(((.((((((…))))))))).)))..))))))))……………….((((((…..)))).)).((.((((….)))).))……(((((….)))))((((((((……))))))))((((..(((……)))…))))….
RS 1 seq CGAAACGCAUAAUUUCAUGGUGAUCUGACAUGUCAGAUCUUAAAUUGGAAUCAGGUGCAAAACCUGGGCGGUCCCGCCGCCGUGAUAGGGAGUCAAGGUAAUAUACCACUGGGAAACUGGGAAGGGUGCCGAGACGAUGAUCUUAAGCCGGAAUACUCGCCAUGAUCUAAGGAUAUAC
RS 1 dot ………..(((((((((.(((((((….))))))))))…))))))(((((…..)))))((((((…)))))).((((…..)))).((((…)))).((.((..(((……))).)).))…..((((….((.((….)).))…))))………..
RS 2 seq AUCCCUUUUCUUAGUUAUGGUGCCUAAACGCCAAAGAGGGAACAUGGUGUAAAUCCGUGACUACCCCCGUAACUGUAAGGGAAGAGCCCACUCCAUAAACCCACUGAAGUCUUUCGGGAAGGGGGAGAAAAAGGGUAAUGAGGCCCGAGUCAGGAGACCUGCCAUAACGAGUCACCAUCC
RS 2 dot .((((((((……..(((((……))))))))))))).(((((…….)))))……………….(((…..))).((((…..(((.(((((….)))))…)))))))…..((((……))))……((.(((.((……)).))).))….
RS 3 seq AGCCGCGGGAUGAUUUACUAUCGCACUGGCUGAAUAAGGGAAGUCGGGUGCAAAUCCCGCGUGAGUCCGUCGCCGUAUUUGGGGACAAAUGCCCAGAGCAGGUCACUGUCGCAAGAUGGGAAGACCGGGCAGGAGAAUGAUCCAUAAGCCGGAAUACCUGUAGAAGCCCAUCGGACCUU
RS 3 dot …((((((((………(.(((((((((……….)))))).))).)))))))))…….(((.(((….))).)))…(((((……((((.(((((….)))))…)))))))))(((……)))…..((((…..((…..))….))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table