Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA041866 Similarity: 0.982 Similarity: 0.976 Similarity: 0.976
UTR: 5HSAA041866
Gene: FRMD1
MFE: -30.666
ENS: 0.771
Length: 90.
Predicted Ligands:
zmp-ztp - 9/20
TPP - 8/20
glycine - 2/20
 RS: URS0000C11F48_1797883
MFE: -31.034
Ligand: zmp-ztp
Species: Deltaproteobacteria bacterium RIFCSPLOWO2_02_FULL_55_12 ZMP/ZTP riboswitch
 RS: URS0000C7B6BA_644283
MFE: -35.435
Ligand: zmp-ztp
Species: Micromonospora aurantiaca ATCC 27029 ZMP/ZTP riboswitch
 RS: URS0000C77027_1423726
MFE: -19.053
Ligand: TPP
Species: Lactobacillus bifermentans DSM 20003 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA041866 URS0000C11F48_1797883 URS0000C7B6BA_644283 URS0000C77027_1423726
Length 90. 89. 90. 90.
Similarity - 0.982 0.976 0.976
Ensemble Norm 0.771 - - -
MFE -30.666 -31.034 -35.435 -19.053
Ligands - zmp-ztp zmp-ztp TPP
Gene FRMD1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4. 12.003 13.002
Length SE - 1. 0. 0.
Lev Distance - 22. 27. 27.
UBS 9. 8. 8. 8.
BS 0. 0. 0. 0.
ILL 3. 3. 2. 4.
ILR 4. 3. 1. 4.
H 3. 3. 3. 2.
BL 3. 2. 3. 0.
BR 0. 1. 1. 1.
UN 0. 0.101 0.044 0.144

Sequences

Field Description
UTR seq + 25 gugaucugggaggugcugagcacccaccugcgacccauggcgggggagggccgaguaacgacagcATGGATGATGTGAAGGCTACTGGCC
UTR dot + 25 …….((..(((((…)))))..))..(..(((……)))..)((((.((((.(..((.(((…..)))))..)..))))))))
RS 1 seq AGAAUCCUCCGUUACUGACGGAAUCAAGGUGGGGGACCACCGGGGAGCGGGGGACUAUAUCGGAUCUGUCGACCGUCUGGGCACCGCGC
RS 1 dot …….((((((…)))))).((..(((((….)))))..)).(((.((..((….(((.((….)))))….))..)).)))
RS 2 seq GGCACAGGCCGUGACUGGCGCGUGGAGAUGGAGCACCAUCGGGGAGCGGCCUCGUCAUGAGGACGCAUGCCGAGCGCCUGGGCCUUCCGC
RS 2 dot ..(((..((((….))))..)))..(((((….)))))(.((((.(((((…….(((.(((…….))))))))))))))).)
RS 3 seq UCACAUCGUCUGGGGUGCCGCAAGGCUGAGAAUAGACCCAUGAACCUGAUAUCGUUAACACGGCCGAAGGAAGUACGCAUUGCAGGAAAU
RS 3 dot ……..((..(((((((….)))………))))..)).((((..(((((….((..((…))..))))).))..))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table