Detected as a riboswitch by 13 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA041946 Similarity: 0.984 Similarity: 0.984 Similarity: 0.983
UTR: 5HSAA041946
Gene: FSCN2
MFE: -6.652
ENS: 0.876
Length: 38.
Predicted Ligands:
SAM - 10/20
preQ_1 - 6/20
fluoride - 1/20
RS: URS0000BE9632_1514904
MFE: -10.995
Ligand: SAM
Species: Ahrensia marina SAM riboswitch (alpha-proteobacteria)
RS: URS0000BE9AC2_1514904
MFE: -10.827
Ligand: SAM
Species: Ahrensia marina SAM riboswitch (alpha-proteobacteria)
RS: URS0000D87AB1_1686310
MFE: -13.459
Ligand: SAM
Species: Bartonella apis SAM riboswitch (alpha-proteobacteria)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA041946 URS0000BE9632_1514904 URS0000BE9AC2_1514904 URS0000D87AB1_1686310
Length 38. 41. 41. 36.
Similarity - 0.984 0.984 0.983
Ensemble Norm 0.876 - - -
MFE -6.652 -10.995 -10.827 -13.459
Ligands - SAM SAM SAM
Gene FSCN2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.031 3.031 3.134
Length SE - 9. 9. 4.
Lev Distance - 11. 11. 18.
UBS 2. 2. 2. 2.
BS 0. 0. 0. 0.
ILL 0. 1. 1. 1.
ILR 0. 1. 1. 1.
H 2. 1. 1. 1.
BL 0. 0. 0. 0.
BR 0. 0. 0. 0.
UN 0.421 0.244 0.244 0.056

Sequences

Field Description
UTR seq + 25 uucugccaacaccATGCCGACGAACGGCCTGCACCAGG
UTR dot + 25 ……………((((…..))))(((…))).
RS 1 seq AAUAGAUUUCGUGGUGAUUUGGCCGGUCGGCUUGCAGCCAC
RS 1 dot ……….(((((…..((((….))))….)))))
RS 2 seq GUUAUUCAUUGUGGUGAUUUGGCCGGUCGGCUUGCAGCCAC
RS 2 dot ……….(((((…..((((….))))….)))))
RS 3 seq CGUGGUGAUUUGGGCCGGCCGGCUUGCAGCCACGCU
RS 3 dot ((((((…..(((((….)))))…))))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table