Detected as a riboswitch by 10 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA042021 Similarity: 0.978 Similarity: 0.971 Similarity: 0.970
UTR: 5HSAA042021
Gene: FTO
MFE: -36.125
ENS: 0.875
Length: 127.
Predicted Ligands:
cobalamin - 7/20
glycine - 5/20
FMN - 3/20
 RS: URS00003CC219_1003195
MFE: -54.004
Ligand: glycine
Species: Streptomyces cattleya NRRL 8057 = DSM 46488 Glycine
 RS: URS0000AB250C_1229756
MFE: -33.188
Ligand: tetrahydrofolate
Species: Leuconostoc gelidum JB7 THF riboswitch
 RS: URS0000C73588_1123366
MFE: -41.
Ligand: glycine
Species: Thalassospira xiamenensis M-5 = DSM 17429 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA042021 URS00003CC219_1003195 URS0000AB250C_1229756 URS0000C73588_1123366
Length 127. 128. 127. 128.
Similarity - 0.978 0.971 0.970
Ensemble Norm 0.875 - - -
MFE -36.125 -54.004 -33.188 -41.
Ligands - glycine tetrahydrofolate glycine
Gene FTO - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.001 4.001 5.004
Length SE - 1. 0. 1.
Lev Distance - 28. 37. 37.
UBS 12. 12. 11. 11.
BS 0. 0. 0. 0.
ILL 2. 2. 3. 3.
ILR 3. 2. 2. 4.
H 3. 3. 3. 3.
BL 5. 4. 5. 4.
BR 5. 5. 6. 4.
UN 0.047 0.016 0.079 0.109

Sequences

Field Description
UTR seq + 25 uccacguuucuuuagcgggcaguggucgaguuugaguggcugaggcaguuuugguuucaaggcaaucgauacagaaagugcacugacugguggugucaacccATGAAGCGCACCCCGACTGCCGAGG
UTR dot + 25 .((.((((…..))))))((((.((((….))).).)))).(((((((.((((((((.((…..(((((.(..(((……)))..).)))))…)).)))))).))….)))))))….
RS 1 seq UCACUCUGGAAAGCAGGCAGGUGCCGGCGGCGCGCGACACGGCCGGGGCCCCUCCUCACCGACGGGGAAAGCCGUGACCGCGUACCGCGGAGCGGUGAAACUCUCAGGUUCAUGACAGAGGGGGAGGC
RS 1 dot .(((.(((………))))))(((((.(.(…..).).))))).(((((((((((((((.(((….(((((..(((((…))))).)))))….))))).)))……..))))))).)))
RS 2 seq AAAGGGGUAGAUAUCUGCGCGUUAAGUGUGAGGGAGACGGAAUGUGAGCCUUCAACGAAAUAAAAAAUAUCAUGUGGGAAAACCACGUUUUAGUUUUUUGUGCGAUGCAGAUAUCACAUUCACCAAU
RS 2 dot .((.(.((((….)))).).))..((.(…..).)).((((((((..((.((.((..(((((((((…((((((…..))))))….))))))))).)).)).))…))))))))……
RS 3 seq CUCUGGAGAGAGAAAGCGGUACGGGGCCAACGCCCGGCACCAUAUUUCCACCGAAGGAUGAAGCCAUGGCGUCAAAGACUUCUUUGUUUUUGGCAACAGGGCGCACAAUCUCAGGUCAAGGGACAGAG
RS 3 dot ((((….))))…..(((.(.((((….)))).).)))….(((((((..(((.((..(((.((..(((((((((……)))))))))..)).)))…)).)))..)))…))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table