Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA042042 Similarity: 0.983 Similarity: 0.982 Similarity: 0.981
UTR: 5HSAA042042
Gene: FTSJ1
MFE: -17.594
ENS: 0.947
Length: 81.
Predicted Ligands:
cyclic-di-GMP - 8/20
zmp-ztp - 7/20
cobalamin - 2/20
 RS: URS0000C350F0_1390249
MFE: -17.714
Ligand: cyclic-di-GMP
Species: Desulfuribacillus stibiiarsenatis Cyclic di-GMP-II riboswitch
 RS: URS0000D87A44_1797678
MFE: -12.361
Ligand: cyclic-di-GMP
Species: Clostridiales bacterium GWC2_40_7 Cyclic di-GMP-II riboswitch
 RS: URS0000C22553_1743142
MFE: -13.411
Ligand: cyclic-di-GMP
Species: Bacillus sp. FJAT-26390 Cyclic di-GMP-II riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA042042 URS0000C350F0_1390249 URS0000D87A44_1797678 URS0000C22553_1743142
Length 81. 82. 82. 82.
Similarity - 0.983 0.982 0.981
Ensemble Norm 0.947 - - -
MFE -17.594 -17.714 -12.361 -13.411
Ligands - cyclic-di-GMP cyclic-di-GMP cyclic-di-GMP
Gene FTSJ1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2. 13. 10.004
Length SE - 1. 1. 1.
Lev Distance - 21. 19. 21.
UBS 6. 6. 4. 4.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 0.
ILR 0. 1. 1. 0.
H 3. 3. 3. 3.
BL 2. 2. 0. 1.
BR 2. 1. 0. 0.
UN 0.136 0.122 0.134 0.195

Sequences

Field Description
UTR seq + 25 ggauacgucgacaauagaugacggggcucacguuguacguucacaucaggucccggATGGCTCTGAACATTGCTACACATG
UTR dot + 25 …..((((…….)))).(((((((…(.(((……))).).)))))))(.((((……….)))))…..
RS 1 seq AACUUUUAGGAAUGCUAAGAUAUUUAGUCUGUAUGUGGUCACUUGGGCUAGAUGGAGCGAGUAGUGAAACCGAUCCGCACUU
RS 1 dot …((((((…..)))))).((((((((((..((….))..))))))))))(((.((.((……)))).)))……
RS 2 seq GAUAAUUAAUGAUGCGUUGAAAUGUAAUCUGUAUUUGGGCACUUGGAUUACAUGGAGUGAGUAGUGCAACCGGCUUUUUUUU
RS 2 dot …..((((((…)))))).((((((((((…………))))))))))(((((..((……))..)))))…..
RS 3 seq AAAAGCUAGGGAAGCGAUGAAGUAUAAUCUGCAUAUGGACACUUGGAUUAUAUGGAGCCAAUAGUGUAACCGGCCCUCUUAG
RS 3 dot ….(((…..)))……(((((((((…………..)))))))))((.(((…………)))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table