Detected as a riboswitch by 11 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA042117 Similarity: 0.985 Similarity: 0.983 Similarity: 0.983
UTR: 5HSAA042117
Gene: FUCA1
MFE: -29.020
ENS: 0.860
Length: 70.
Predicted Ligands:
fluoride - 10/20
cobalamin - 4/20
homocysteine - 4/20
 RS: URS0000C476C6_1097667
MFE: -23.887
Ligand: cobalamin
Species: Patulibacter medicamentivorans Cobalamin riboswitch
 RS: URS0000D91CA3_1797499
MFE: -29.846
Ligand: homocysteine
Species: Betaproteobacteria bacterium RIFCSPLOWO2_12_FULL_64_23 S-adenosyl-L-homocysteine riboswitch
 RS: URS0000D835E8_1797557
MFE: -29.846
Ligand: homocysteine
Species: Burkholderiales bacterium RIFCSPHIGHO2_12_FULL_61_11 S-adenosyl-L-homocysteine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA042117 URS0000C476C6_1097667 URS0000D91CA3_1797499 URS0000D835E8_1797557
Length 70. 70. 71. 71.
Similarity - 0.985 0.983 0.983
Ensemble Norm 0.860 - - -
MFE -29.020 -23.887 -29.846 -29.846
Ligands - cobalamin homocysteine homocysteine
Gene FUCA1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.010 4.003 4.003
Length SE - 0. 1. 1.
Lev Distance - 19. 20. 20.
UBS 7. 6. 6. 6.
BS 0. 0. 0. 0.
ILL 3. 3. 2. 2.
ILR 1. 1. 2. 2.
H 1. 1. 1. 1.
BL 2. 2. 2. 2.
BR 3. 2. 2. 2.
UN 0.043 0.143 0.099 0.099

Sequences

Field Description
UTR seq + 25 gggcaccugcgcguuaagagugggccgcgucgcugagggguagcgATGCGGGCTCCGGGGATGAGGTCGC
UTR dot + 25 .(((..((.(.((….((((…(((((((((((…..))))))))))))))))).).).)..)))..
RS 1 seq GAGGAAGCCGGUGCAAGUCCGGUGCGGUCGCGCCACUGUGAUCGGCCCACGGGCCGGGAGCCAGAGACUC
RS 1 dot ..((…(((((.(..((..(((.(((((((……)))))))))).))).)))))…))……..
RS 2 seq GUAUCCAAGGAGCGUUGCAGCGGGUCAGAAGGCCCGUCAGGCUUGGAUGACCCCAACGACGCUCACCUGAU
RS 2 dot …..((.(((((((((..(.((((((..(((((…..)))))…)))))))..)))))))).).))..
RS 3 seq AUAUCCAAGGAGCGUUGCAGUGGGUCAGAAGGCCCGUCAGGCUUGGAUGACCCCAACGACGCUCACCUGAU
RS 3 dot …..((.(((((((((..(.((((((..(((((…..)))))…)))))))..)))))))).).))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table