Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA042346 Similarity: 0.974 Similarity: 0.971 Similarity: 0.969
UTR: 5HSAA042346
Gene: FYN
MFE: -23.699
ENS: 0.733
Length: 128.
Predicted Ligands:
cobalamin - 9/20
TPP - 4/20
FMN - 3/20
 RS: URS0000AB23FD_12908
MFE: -29.527
Ligand: cobalamin
Species: unclassified sequences AdoCbl variant RNA
 RS: URS0002325B27_1552
MFE: -22.016
Ligand: cobalamin
Species: Clostridium estertheticum subsp. estertheticum Cobalamin riboswitch
 RS: URS0000AB1B38_12908
MFE: -35.187
Ligand: cobalamin
Species: unclassified sequences AdoCbl variant RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA042346 URS0000AB23FD_12908 URS0002325B27_1552 URS0000AB1B38_12908
Length 128. 129. 129. 129.
Similarity - 0.974 0.971 0.969
Ensemble Norm 0.733 - - -
MFE -23.699 -29.527 -22.016 -35.187
Ligands - cobalamin cobalamin cobalamin
Gene FYN - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.003 9.001 1.006
Length SE - 1. 1. 1.
Lev Distance - 33. 34. 40.
UBS 9. 10. 9. 9.
BS 0. 0. 0. 0.
ILL 1. 1. 3. 1.
ILR 3. 3. 3. 3.
H 2. 2. 2. 2.
BL 4. 4. 2. 4.
BR 4. 3. 3. 3.
UN 0.242 0.186 0.209 0.163

Sequences

Field Description
UTR seq + 25 aaaugaucaaguguuggguauaagccaaggagcugagagagggggagaccagcgcaggucugaggagcugagaagggaggcuuacgugaagggaauuuagauaATGGGCTGTGTGCAATGTAAGGATA
UTR dot + 25 ……(((..(.((.(((….))).)).)..)))………..((((((.((.((((((((((((………)))))…………)))))))..)).)))).))…………..
RS 1 seq UUGCUGAAUCAUGGUGGGGAAUCAGUGUGAAAUUCAUUGGCUCUUCCUGGAACCGUAAAGUCGGAGUACCACCCAGUAAAGUCCGCUGUUGAAUGAUGGCCAGGAAAAGUCUAGUUCUACAAUUAAAAA
RS 1 dot ….(((((((((.(((….))).)))))..))))..((((.(((((((..((((((((.((((.(((……)))…)))))).))…..))))))))))).))))………………
RS 2 seq CAAUAGAAUAUAAUUUUAGGUGCCUAGAGUAUUAGGUGAAAAGGGAAUGUGGUUUAAGUCCGCAGCAGCCCCCGCUACUGUAAUUGAGAAAUCAAAAGCCAGGAGACCUGCCUAAAUGAUGUUAACAAA
RS 2 dot …………(((((((….))))))).((((((….(((…(.((((((…(((((((.(((….))).))))….).))……)))))).)…)))))))))…………..
RS 3 seq GUACUGAAUCUUGACGGGGAAUUAGUGCGAAAUUCACUUGCUGUUCCUGCAACCGUAUAGUCGGAGUGCCGUCCAGUAUAGUCCGCUGUUGAGCGAUGGCCAGGAAAAGCCUAGUUCUGCAAUUUAAUU
RS 3 dot (((((((.((((….)))).)))))))…….(((.(((.((((((…((((((((.((((((((……))))..))))))))……)))).)))))).)))..)))…………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table