Detected as a riboswitch by 10 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA042351 Similarity: 0.984 Similarity: 0.982 Similarity: 0.981
UTR: 5HSAA042351
Gene: FYN_0
MFE: -16.617
ENS: 0.859
Length: 79.
Predicted Ligands:
SAM - 16/20
glutamine - 1/20
fluoride - 1/20
 RS: URS0000BE6A87_1579316
MFE: -22.743
Ligand: SAM
Species: Halocynthiibacter arcticus SAM riboswitch (alpha-proteobacteria)
 RS: URS0000D7F4EA_1860089
MFE: -18.070
Ligand: SAM
Species: Roseobacter sp. MedPE-SWchi SAM riboswitch (alpha-proteobacteria)
 RS: URS0000BE1F43_1123237
MFE: -20.280
Ligand: SAM
Species: Salipiger mucosus DSM 16094 SAM riboswitch (alpha-proteobacteria)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA042351 URS0000BE6A87_1579316 URS0000D7F4EA_1860089 URS0000BE1F43_1123237
Length 79. 79. 79. 78.
Similarity - 0.984 0.982 0.981
Ensemble Norm 0.859 - - -
MFE -16.617 -22.743 -18.070 -20.280
Ligands - SAM SAM SAM
Gene FYN - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.001 6. 11.003
Length SE - 0. 0. 1.
Lev Distance - 19. 22. 20.
UBS 6. 6. 6. 5.
BS 0. 0. 0. 0.
ILL 0. 2. 2. 0.
ILR 2. 2. 1. 2.
H 2. 2. 2. 2.
BL 3. 1. 2. 0.
BR 2. 2. 2. 1.
UN 0. 0.025 0. 0.051

Sequences

Field Description
UTR seq + 25 cagcgcaggucugaggagcugagaagggaggcuuacgugaagggaauuuagauaATGGGCTGTGTGCAATGTAAGGATA
UTR dot + 25 ((((.((.((((((((((((………)))))…………)))))))..)).))))(((.(…….).)))
RS 1 seq UAGGCGUCCUGUGGCGAUUUGUUCUCCUGAUUGCGGGCCACGUUAAAUAUGCCGCUAAAGAGGUCUGGGACGUACCCCC
RS 1 dot .((((.((..(((((((((((….((((….))))……))))).))))))….)).))))(((……))).
RS 2 seq UUCUUUGGACGUGGUAGAUUUGUAACCGGAUUGCGGGCCACGCAAAAUAUCCCGCUAAAGAGGUCAGGAUGUGAAGGAC
RS 2 dot ((((((((.((.((((..(((((..(((…..)))…..))))).)))).))))))))))(((………..)))
RS 3 seq CCGACUGGGCGUGGCGAUUUGUUACCGGAUUGCGGGCCACGUUAAACACGCCGCUAAAGAGGUCGAAGGAAAGAGCCC
RS 3 dot .((((((((((((((((((((….))))))))………….)))))).)……)))))..((……)).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table