Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA042615 Similarity: 0.943 Similarity: 0.941 Similarity: 0.941
UTR: 5HSAA042615
Gene: GABRA2
MFE: -43.779
ENS: 0.963
Length: 195.
Predicted Ligands:
lysine - 8/20
TPP - 5/20
cobalamin - 4/20
 RS: URS0000C71334_1203606
MFE: -71.158
Ligand: lysine
Species: Butyricicoccus pullicaecorum 1.2 Lysine riboswitch
 RS: URS0000C611E0_1420902
MFE: -77.574
Ligand: TPP
Species: Pseudogymnoascus sp. VKM F-4246 TPP riboswitch (THI element)
 RS: URS0000C73683_1420907
MFE: -75.274
Ligand: TPP
Species: Pseudogymnoascus sp. VKM F-4513 (FW-928) TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA042615 URS0000C71334_1203606 URS0000C611E0_1420902 URS0000C73683_1420907
Length 195. 195. 194. 194.
Similarity - 0.943 0.941 0.941
Ensemble Norm 0.963 - - -
MFE -43.779 -71.158 -77.574 -75.274
Ligands - lysine TPP TPP
Gene GABRA2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 19. 7.004 7.004
Length SE - 0. 1. 1.
Lev Distance - 66. 74. 74.
UBS 13. 15. 11. 11.
BS 0. 0. 0. 0.
ILL 2. 3. 3. 3.
ILR 5. 4. 5. 5.
H 3. 3. 2. 2.
BL 4. 6. 4. 4.
BR 4. 7. 3. 3.
UN 0.067 0.087 0.129 0.129

Sequences

Field Description
UTR seq + 25 gucaaacgcgucguuucgcagcacuugaucggaacccggcugccucuaagacuuggucuugggcaaccgugggugggcaggaagggaaauuauuuauuuuauuuuguuaaggggagugaagaaaagaagacgugaggaccgcaguucacuguaauguagaagcggcggugATGAAGACAAAATTGAACATCTACA
UTR dot + 25 ……((((((.((((((..(.(((((.((((((((..(((((((((((((…)))))))…………))))))…)))……………)))))))))).)..))))))…….))))))…(((((.((((((……)).))).).)))))((((…………..))))….
RS 1 seq CCUUCAGAUAGAGGCGCGGUGUUCAUCAGUAUCGUCUGGGAGGGGCCGUAACCCCGGUGACCAUACGAAAAAGGGACCAUCGCCGAAGGUCAGCCUGCGUUACGGCACGGUCGUCCUGGAUGCCGCGGAGAAUAUCCCGUCGUCUGUCACUGCAUAGAACGAUUCGCGCUGUGCCGGUGGAGUGCUGUCUUGGUU
RS 1 dot ……((((((((((.(((((((.((.((..(((((((((.((((((((((.(.(((((((…(((………..)))…..))))).)).).))))))))….)).)))))))))..)).))))))))).)))).))))))…((((((..((…))..))))))((((…..))))……..
RS 2 seq UCAUAGCAUGACGGGUGUCCAGGUCCUCAACUGUUUCUUUCAGCUCAACUCUGCCGUGGUGGCUAUGGUCUCACGACCCUCCAUUCAUUGCGAGUCCGAGCUGGAGGAGGCAGUUGAAGACCUGGUUCUGAGAUUAUACCGUAUGAACUUGAUCUAGACAAUUCUAGCGCAUAAGGACAUGCUUCCCCCUCCCC
RS 2 dot ………….((((((((((((.((((((((((((((((((((.((((.((.(((((((….((((….))))..)))).))).))))))..)))))))))))))))))))).)))))))……….)))))(((((..((((..(((((….)))))….))))..)))))…………
RS 3 seq UAAUAGCAUGACGGGUGUCCAGGUCCUCAAUUGUUUCUUUCAGCUCAACUCUGCCGUGGUGGCUAUGGUCUCACGACCCUCCAUUCAUUGCGAGUCCGAGCUGGAGGAGGCAGUUGAAGACCUGGUUCUGAGAUUAUACCGUAUGAACUUGAUCUAGACAAUUCUAGCGCAUAAGGACAUGCUUCCCCCUCCCC
RS 3 dot ………….((((((((((((.((((((((((((((((((((.((((.((.(((((((….((((….))))..)))).))).))))))..)))))))))))))))))))).)))))))……….)))))(((((..((((..(((((….)))))….))))..)))))…………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table