Detected as a riboswitch by 7 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA042617 Similarity: 0.960 Similarity: 0.949 Similarity: 0.948
UTR: 5HSAA042617
Gene: GABRA2_0
MFE: -36.845
ENS: 0.850
Length: 166.
Predicted Ligands:
FMN - 6/20
lysine - 4/20
Mg2+ - 3/20
 RS: URS0000AB582E_585524
MFE: -27.285
Ligand: Mg2+
Species: Lactobacillus amylolyticus DSM 11664 M-box riboswitch (ykoK leader)
 RS: URS0000ABBB0F_537013
MFE: -43.312
Ligand: Mg2+
Species: Clostridium methylpentosum DSM 5476 M-box riboswitch (ykoK leader)
 RS: URS00022D596D_92647
MFE: -55.624
Ligand: FMN
Species: Paraburkholderia tropica FMN
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA042617 URS0000AB582E_585524 URS0000ABBB0F_537013 URS00022D596D_92647
Length 166. 167. 166. 165.
Similarity - 0.960 0.949 0.948
Ensemble Norm 0.850 - - -
MFE -36.845 -27.285 -43.312 -55.624
Ligands - Mg2+ Mg2+ FMN
Gene GABRA2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.006 16.003 17.021
Length SE - 1. 0. 1.
Lev Distance - 50. 60. 59.
UBS 12. 11. 14. 14.
BS 0. 0. 0. 0.
ILL 2. 3. 3. 2.
ILR 0. 1. 3. 3.
H 4. 3. 5. 4.
BL 5. 4. 6. 3.
BR 6. 5. 6. 6.
UN 0.205 0.281 0.151 0.061

Sequences

Field Description
UTR seq + 25 agcacuugaucggaacccggcugccucuaagacuuggucuugggcaaccgugggugggcaggaagggaaauuauuuauuuuauuuuguuaaggggagugaagaaaagaagacgugaggaccgcaguucacuagcggcggugATGAAGACAAAATTGAACATCTACA
UTR dot + 25 ….((((.((.(..(((((.(((((..(((((…)))))))))).))).)).).))))))……..((((((.(((((……))))).))))))………………(((((.(((….))).)))))((((…………..))))….
RS 1 seq CAAAUGAACUGUUAGGUGAGACUCCUACGUGAACAUAUGCUGAUGCCCAGCAACAUCUAGAGAUGCCAACGAGUAAAACAAGAAUGGUCGAUACAAGGCUUUUCUCAGUCAGCUAAUUUAACCAAUUUACGUCACGUAGUGUUAAAACUGAACGACGAGUAAAAAUC
RS 1 dot …….((((((.((((…((.(((.(((……(((((…..))))).))).))))).))))))).)))……((((.((((…….)))).))))……………………((((…((((……))))…))))……….
RS 2 seq AAAGAACACCGUUAGGUGAGGUUACUUUACGGAUAUGGCUAUUGCCCGGAAAUGUCGAGAGACGCCAACGGGUCAGUUGACACUAUCGAAUCAAGGUUUUGUCUAAUAUAGCUGACAGUUCUGUCUAUGCCGUAGAGAGCCAAAGCUCGACGAACAGGGGUGUGGC
RS 2 dot ……..((((.(((((….))))).))))….(((….)))(((…((((((..(((.(….).)))..))))))…)))………….(((..(((.((.((((….))))…)).))).)))((((.(.(((……..))).).))))
RS 3 seq ACACGUUCUCGGGGCGGGGUGAGAUUCCCCACCGGCGGUAAUCGUCCAAUACGACGUAGCCCGCGAGCGCUCUGCCAUCGCAACCUGCUUGACGCGAUCGCAGAGGUCAGCAGACCCGGUUGGAUUCCGGGGCCGACGGUAUAGUCCGGAUGAAAGAGAACAGGA
RS 3 dot …(((((.(((((((..((((((((((((…)).)).)))).))….))..)))..)))).)))))((((((.(((((…………))))).))))))(((.((…(((((…….))))))).)))…….(((……………)))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table