Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA042857 Similarity: 0.970 Similarity: 0.968 Similarity: 0.967
UTR: 5HSAA042857
Gene: GALNT1
MFE: -20.962
ENS: 0.906
Length: 130.
Predicted Ligands:
TPP - 8/20
FMN - 6/20
cobalamin - 5/20
 RS: URS00023325FD_944560
MFE: -52.693
Ligand: FMN
Species: Actinomyces sp. oral taxon 175 str. F0384 FMN riboswitch (RFN element)
 RS: URS0002322623_1220578
MFE: -36.262
Ligand: cobalamin
Species: Flavihumibacter petaseus NBRC 106054 Cobalamin riboswitch
 RS: URS0000C5CFA1_1703404
MFE: -50.494
Ligand: TPP
Species: Gammaproteobacteria bacterium SG8_30 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA042857 URS00023325FD_944560 URS0002322623_1220578 URS0000C5CFA1_1703404
Length 130. 130. 131. 130.
Similarity - 0.970 0.968 0.967
Ensemble Norm 0.906 - - -
MFE -20.962 -52.693 -36.262 -50.494
Ligands - FMN cobalamin TPP
Gene GALNT1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.005 6.010 5.026
Length SE - 0. 1. 0.
Lev Distance - 39. 39. 43.
UBS 9. 9. 9. 10.
BS 0. 1. 0. 0.
ILL 3. 2. 3. 4.
ILR 2. 3. 3. 3.
H 4. 4. 4. 3.
BL 1. 2. 2. 2.
BR 3. 3. 1. 3.
UN 0.008 0.077 0.107 0.169

Sequences

Field Description
UTR seq + 25 aggguaugaacgugauuucugaugaaacuggauuggaauaauuuucaugaucuuuguauauuuauauauauauauuuuuaaauuuugcauuugacuuaaagugccATGAGAAAATTTGCATACTGCAAGG
UTR dot + 25 ((((((((((.((…(((((((……..)))))))..)).))))).)))))(((((((……)))))))(((((..((…((((((……)))))).))..)))))((((((…)))))).
RS 1 seq UCGUGUGCUCUGGGGUCGGUGAAAGUCCGAACCGGCGGUGACAGUCCGCGACCCGGUCGCAUCCAGCGACCGGCUGACCAGGUGGAACUCCUGGACCGACGGUGAGAGUCCGGAUGGGAAGCGCACACGG
RS 1 dot .(((((((….((.((((…….)))).)).((((…….))))…((((((((…..))))))))((..(((..((((.((((((……))).)))..))))..)))..)).))))))).
RS 2 seq UCUUAAAUAAUAUGUGAAGGUGCAAUACUUCCGGUAUUGCUUAAAAGGGAACCACGUGUAAUUCGUGGGCUGACGGGCAACUGUGAUCCGCCUAGCGGAAGCCAGAUACCUGCCGAAACAUAUUUGUUUGG
RS 2 dot ..((((.((((((..((((……..))))..)))))).))))…….(((((…….)))))…..((((…(((…(((((…)))))…)))…))))((.(((((….)))))))
RS 3 seq CGAGCAGCCUUGGGGUGGUCUGACUGGACCUGAGACGCCGGCCGCUCGCGCAAGCCGCGGAGCUCACCGGCGAACCCGUUGAACCUGAUCCGGCUAGUACCGGCGUAGGGAGCGGGCAUGAAACACGAAG
RS 3 dot (((((.(((..((.(((((((….)))))….)).))))).)))))…..((((..(….)..))))…((((((…((((..((((……))))..)))).))))))…………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table