Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA042859 Similarity: 0.976 Similarity: 0.975 Similarity: 0.975
UTR: 5HSAA042859
Gene: GALNT1_0
MFE: -19.429
ENS: 0.940
Length: 116.
Predicted Ligands:
TPP - 18/20
FMN - 2/20

 RS: URS0000C1C1FF_1716141
MFE: -51.650
Ligand: TPP
Species: Streptomyces jeddahensis TPP riboswitch (THI element)
 RS: URS0000C57AA1_1736388
MFE: -25.767
Ligand: TPP
Species: Paenibacillus sp. Soil522 TPP riboswitch (THI element)
 RS: URS0000D7AD89_1945884
MFE: -35.084
Ligand: TPP
Species: Olsenella sp. KH1P3 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA042859 URS0000C1C1FF_1716141 URS0000C57AA1_1736388 URS0000D7AD89_1945884
Length 116. 114. 115. 115.
Similarity - 0.976 0.975 0.975
Ensemble Norm 0.940 - - -
MFE -19.429 -51.650 -25.767 -35.084
Ligands - TPP TPP TPP
Gene GALNT1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2. 9. 4.006
Length SE - 4. 1. 1.
Lev Distance - 27. 29. 31.
UBS 6. 6. 8. 5.
BS 0. 0. 0. 0.
ILL 0. 1. 1. 1.
ILR 1. 1. 2. 1.
H 5. 5. 4. 4.
BL 1. 0. 2. 0.
BR 0. 0. 1. 0.
UN 0.233 0.219 0.226 0.313

Sequences

Field Description
UTR seq + 25 auuucugaugaaacuggauuggaauaauuuucaugaucuuuguauauuuauauauauauauuuuuaaauuuugcauuugacuuaaagugccATGAGAAAATTTGCATACTGCAAGG
UTR dot + 25 .((((….))))..(((((.(((…..)))..))))).(((((((……)))))))…………((((((……))))))……….((((((…)))))).
RS 1 seq CACCGUACUCGCGGGAGCCCGGACGUACCGGGCUGAGAGGGAGGCUGGGACGGCCUCCGACCGUACGAACCUGAUCCGGGUCAUGCCGGCGAAGGGAGGGGCUCGACGCCCAUG
RS 1 dot ..((((….)))).(((((((…..)))))))…..((((((((…))))))))………..(((…((((……))))…)))…((((…..))))…
RS 2 seq GAAUAUGUUCCGGGGAGCUGCUAAAGCCGGCUGAGAGGGAAUUAUCUGUACAAUUCCGACCCGUUAAAACCUGAUCUGGAUAAUGCCAGUGUAGGGACAGAAGCUUUGUUUGCUU
RS 2 dot ……..(((((.(.(((…..))))..))).)).((((((……..))))))…………((((..((((……))))..))))…..((((…….))))
RS 3 seq UGGACGCACACGGGGAGCUGGGGAUUUGGCCCGGCUGAGAGGAAUGACCCAAUCAUUCGACCCUAGAACCUGAUCCGGGUAAUGCCGGCGUAGGGACCAGAGCACCGCAUGUUCG
RS 3 dot ……………(((((((…….)))))))…..((((((…..))))))……….((((..((((……))))..))))…..(((((…..))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table