Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA042903 Similarity: 0.965 Similarity: 0.964 Similarity: 0.962
UTR: 5HSAA042903
Gene: GALNT3
MFE: -18.257
ENS: 0.844
Length: 133.
Predicted Ligands:
cobalamin - 7/20
TPP - 5/20
molybdenum - 3/20
 RS: URS000232BFC3_1736540
MFE: -45.929
Ligand: cobalamin
Species: Aeromicrobium sp. Root472D3 Cobalamin riboswitch
 RS: URS000231BE9E_1897021
MFE: -26.140
Ligand: cobalamin
Species: Ruminococcus sp. CAG:9-related_41_34 Cobalamin riboswitch
 RS: URS0000ABBC96_650150
MFE: -25.917
Ligand: glucosamine
Species: Erysipelothrix rhusiopathiae str. Fujisawa glmS glucosamine-6-phosphate activated ribozyme
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA042903 URS000232BFC3_1736540 URS000231BE9E_1897021 URS0000ABBC96_650150
Length 133. 133. 133. 133.
Similarity - 0.965 0.964 0.962
Ensemble Norm 0.844 - - -
MFE -18.257 -45.929 -26.140 -25.917
Ligands - cobalamin cobalamin glucosamine
Gene GALNT3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.005 9. 5.001
Length SE - 0. 0. 0.
Lev Distance - 45. 45. 49.
UBS 7. 8. 8. 6.
BS 0. 0. 0. 0.
ILL 2. 3. 3. 1.
ILR 2. 1. 3. 1.
H 4. 4. 3. 5.
BL 0. 1. 2. 0.
BR 1. 3. 2. 0.
UN 0.128 0.060 0.143 0.165

Sequences

Field Description
UTR seq + 25 guacuaccauuaaagauaccuucuucucagcaaaucuaugauaaaaaauauaaguaacagaagaagaaauaacuguuauuugucaagugacaagcuuuuaaugucagaATGGCTCACCTAAAGCGACTAGTAA
UTR dot + 25 (((((……..)).)))((((((((………(((……..)))……..))))))))…….((((((((…)))))))).(((((….((((…))))……)))))………
RS 1 seq CGACGGCUGUGCCACACUGAAUCAGCUCACGGCAACGGUGCAAGGAACCCGGUGGAACUCCGGGACGGUCGCGCCACUGUGACCGGGUCACCAGACCCGGGAGUCAGAGACUUCUCCGUUGCCUCCACUCAUA
RS 1 dot …..((((………….))))((((((….(((((……(((((…….)))))……))))).))))))(((((((….)))))))((((..(((.(………).))).))))…
RS 2 seq GCAAUGUUAUAACGCAAAGGUUGCAUCGUACUUGAUGCGCAAAAGAGAAUCCGGUGAGAAACCACUGGGAAACCGGGAAGGGAGAAACAGCGAUGAUCGAAGUCAGGAGAACUGCCUUGGCGUAGAAUUUAAG
RS 2 dot .((((.((……..)).))))((((((..((..(.(………..(((((((……)))))))………..).)..))..))))))……((((((……..))))))…………
RS 3 seq UUAGGAAUUUAAGCGCCUGGCUCAUAUAGAGCGACGAGGAAAGAGGAGAAUCGAGACUUCGGCGGAUGCCUCUUCGGUUAUAUGGAAUCGUAAGAUAAGGACAAAUUGAACAAAUCCCUUAUCACCCAUAAUC
RS 3 dot .((((……….))))((((…..))))……..((((((….((((….))))……))))))(((((……)))))…(((((((…………….)))))))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table