Detected as a riboswitch by 11 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA043037 Similarity: 0.964 Similarity: 0.963 Similarity: 0.962
UTR: 5HSAA043037
Gene: GAPDHS
MFE: -48.459
ENS: 0.884
Length: 141.
Predicted Ligands:
TPP - 8/20
cobalamin - 7/20
FMN - 4/20
 RS: URS000232EB4D_56427
MFE: -53.293
Ligand: cobalamin
Species: Couchioplanes caeruleus subsp. caeruleus Cobalamin riboswitch
 RS: URS00007D9883_408184
MFE: -66.999
Ligand: TPP
Species: Mesorhizobium sp. ORS 3359 TPP
 RS: URS0000C20094_93220
MFE: -57.526
Ligand: TPP
Species: Pandoraea pnomenusa TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA043037 URS000232EB4D_56427 URS00007D9883_408184 URS0000C20094_93220
Length 141. 141. 142. 143.
Similarity - 0.964 0.963 0.962
Ensemble Norm 0.884 - - -
MFE -48.459 -53.293 -66.999 -57.526
Ligands - cobalamin TPP TPP
Gene GAPDHS - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.002 14.002 3.
Length SE - 0. 1. 4.
Lev Distance - 44. 42. 45.
UBS 11. 13. 11. 11.
BS 0. 0. 0. 0.
ILL 1. 3. 4. 2.
ILR 4. 4. 5. 3.
H 2. 2. 2. 3.
BL 2. 3. 2. 2.
BR 5. 6. 3. 5.
UN 0.078 0.035 0.035 0.077

Sequences

Field Description
UTR seq + 25 gucacugggugcugugacaucagggcaauuagcccaggacccacagcccuggcgcuccgcacgcaccucgguaacaucacagcagguccaggccaaugauaaccuuauaagaggccATGTCGAAGCGCGACATCGTCCTCA
UTR dot + 25 (((((((((((((((((.((((((((….((((((((………))))).)))……)).))).)))….))))))))..)))))…..))))……….(((((.((((((…..)))))).).)))).
RS 1 seq CAGAACGGCCGGUGAGCCUGUGGGAUAGCGUCAACCUGACCGCGUAGCAGCGAAGCCGGUGGGAUUCCGGCGCUGUCCCGCAACUGUGAAGUCCUGUACCCCGGGCGUAGCCAGGUCGCCUGCACGCUGGUCGCGAUUCCG
RS 1 dot (((.((..(((((…..((((((((((((((…((.(((((((….)))….)))).))…..)))))))))))))))))).)..)).)))…..(((((((.((((((((….).)).))))).)))..))))
RS 2 seq AUCGGGGCCGACGGGCGCGGCCGGCGUGGUGGCCAUGGAGUUGCUCUCGUCAGCUCCAGCGGCUGAGAUACUGCUAUCACGCGCAGUGACCCGUCGAACCUGAUCCAGGUAUACCGGCGCAGGUACGGUGCGAAGGUUCGCG
RS 2 dot ((((((..((((((((((.((..(((((((((((.(((((((((….).))))))))..))))………..))))))))).))).)))))))..))))))….((..(((..((((…….))))..)))..)).
RS 3 seq CGGGCGAAACAGGGGUGCUCCGUGUCGGACGCGGGGGUUAACUGACAAGGUUAACCAUGCGUCACAAAGGAACGCGGGGCUGAGAGAGACCCUUUGCACCCGACCCGGGUAAUACCGGCGUGGGAAGUUUCCGACUCCUCCAG
RS 3 dot ((((.(….(((((((((((((((((((((((..((((((((…..)))))))).)))))).)….)).))))))))……..))))))..).))))..((((……)))).((.(((….))).))……..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table