Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA043245 Similarity: 0.971 Similarity: 0.969 Similarity: 0.968
UTR: 5HSAA043245
Gene: GART
MFE: -28.495
ENS: 0.922
Length: 124.
Predicted Ligands:
TPP - 10/20
cobalamin - 4/20
molybdenum - 2/20
 RS: URS0002330D92_313612
MFE: -29.585
Ligand: cobalamin
Species: Lyngbya sp. PCC 8106 Cobalamin riboswitch
 RS: URS0000AB721E_290317
MFE: -25.941
Ligand: TPP
Species: Chlorobium phaeobacteroides DSM 266 TPP riboswitch (THI element)
 RS: URS00023165D2_1986696
MFE: -24.876
Ligand: cobalamin
Species: Euryarchaeota archaeon TMED85 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA043245 URS0002330D92_313612 URS0000AB721E_290317 URS00023165D2_1986696
Length 124. 126. 124. 125.
Similarity - 0.971 0.969 0.968
Ensemble Norm 0.922 - - -
MFE -28.495 -29.585 -25.941 -24.876
Ligands - cobalamin TPP cobalamin
Gene GART - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10. 4.017 7.001
Length SE - 4. 0. 1.
Lev Distance - 30. 41. 39.
UBS 7. 9. 8. 8.
BS 0. 0. 0. 0.
ILL 2. 2. 1. 3.
ILR 2. 3. 2. 4.
H 2. 2. 2. 1.
BL 1. 3. 2. 1.
BR 2. 3. 3. 2.
UN 0.137 0.119 0.266 0.168

Sequences

Field Description
UTR seq + 25 uaaauguacugcuccgacuuguggguccuauacagaaggaaaugaugcacugagaguuugacuuacaaggaaucuggaguagauaucgcagcuggaaauATGGCAGCCCGAGTACTTATAATTG
UTR dot + 25 …((((.(((((((((((((((((((…..(((…………..)))…….))))))))))…)).)))))))))))((..((((………)))).))…………..
RS 1 seq AGUUAUUACUCGUUAAACAGUAACCUGUUGGGAAACUCCGGUGAAACUCCGGGGCUGUGCGGCAACUGUAAGUCAUUCACGAGCAAAUUGACAAGCCAGAAGGCCAACUGGUUACGCACCACUCUA
RS 1 dot .((((((.(((((.(((((((….(((((.(…((((((…….))))))…).))))))))))……)).))))).))..)))).((((((……..))))))………….
RS 2 seq AUAUCAUCUUGGGGGUGCUGUCUUUUCCACUGUCUUCAGUGACCACCGGUAAACGAUAGCUGAGAUUAAACCCUUGUAACUUGAUGCAGGUAAUGCUGACGCAAGAAAAGAUGAAGCUGGCCUU
RS 2 dot ……….((((((((((((.(((((…(((……)))….)).))).))))))………))))))….((((.(((((……))).))))))……………….
RS 3 seq AAACGUAUUAACCUAUGAGGUGCUCACUAAGAGAGAAUAGGGAAGAUGGUGAAAUUCCAUCGCGGUCGCGCCACUGUAAUUGUGAAAGCAUAAGUCAGGAGACCUGCCUUGUAGGAAGAUUCAAC
RS 3 dot ………..((((((((((((((((…..((..((((((..(((.((((…….)))).)))…)).))))..))))))..))…………….))))))))))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table