Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA043278 Similarity: 0.945 Similarity: 0.934 Similarity: 0.933
UTR: 5HSAA043278
Gene: GAS2
MFE: -83.683
ENS: 0.834
Length: 217.
Predicted Ligands:
cobalamin - 18/20
glucosamine - 1/20
lysine - 1/20
 RS: URS00023273DF_47857
MFE: -95.858
Ligand: cobalamin
Species: Micromonospora echinaurantiaca Cobalamin riboswitch
 RS: URS0002319078_291594
MFE: -100.505
Ligand: cobalamin
Species: Micromonospora rifamycinica Cobalamin riboswitch
 RS: URS000232D229_553198
MFE: -78.495
Ligand: cobalamin
Species: Propionibacterium acidifaciens F0233 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA043278 URS00023273DF_47857 URS0002319078_291594 URS000232D229_553198
Length 217. 216. 217. 215.
Similarity - 0.945 0.934 0.933
Ensemble Norm 0.834 - - -
MFE -83.683 -95.858 -100.505 -78.495
Ligands - cobalamin cobalamin cobalamin
Gene GAS2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 12.001 11.003 28.
Length SE - 1. 0. 4.
Lev Distance - 66. 83. 68.
UBS 18. 18. 17. 14.
BS 0. 1. 0. 0.
ILL 7. 5. 5. 5.
ILR 4. 5. 5. 6.
H 4. 3. 6. 4.
BL 5. 7. 5. 3.
BR 4. 5. 3. 4.
UN 0.014 0.051 0.069 0.028

Sequences

Field Description
UTR seq + 25 ccgugcgaauggggccaugccgaccaaagcgccgauggauguggcgcagguagcgcgcccacugcaaggcccggcgcacgguggcggggucccaggugcugacguagguagugcuugagaccgccagaagcucggaaaagcgauccaggugcugcagaagggauuccaugagguauuacaaguggauaaauaATGTGCACTGCTCTGAGCCCAAAGG
UTR dot + 25 (((((((..(.(((((.((((((((…((((((…….)))))).)))..))……..))).))))).))))))))((((..((((.((((((((.((….)))))))))).))))))))…(((((((…((……(((((.(((……..(((((..(……)..)))))…….)))))))))))))))))((…))
RS 1 seq AGGCUGUCACCCGGCGCUGGUUCGCCCGGCCGGGUUCGGCCGGGCGUCGUAAGAGGGAACCCGGUGCAAGUCCGGGACUGCCCCGCAGCGGUGAGUGGGAACGACCGCCGUCACCACGCACUGGACCGCGAGGUCUGGGAAGCGACGGCCAGUAGGAGACCGGCACGCCCGGUCGCGCCCGCGAGUCCGAAGACCUGCCCGCGCUGCGCACACGAG
RS 1 dot .(((.((..(((((((((((((((((((((((….)))))))))………..))))).)))))…..)))))).))).((((((((((.((((..(((…..)))..)))).))).((…((.((((((.(((..((.(((.(.((….((((((…..))))))))).)))))..)))..)))))))))).)))))))……..
RS 2 seq AUGGUGUGCCACGCAGCUGGUUCGGCCGGGCCCGGUGGUCCGGUCGAGGCAACAGGGAACCCGGUGUAAAUCCGGGACUGCCCCGCAGCGGUGAGUGGGAACGACCGCCGUCAUCGAGCACUGGACCGCGAGGUCUGGGAAGCGACGGCCAGUAGGCGACCGGUGGACCCCGGUCCGGCCCGCGAGUCCGAAGACCUGCCAGCGCGCCGUGCGCUGC
RS 2 dot ..(.((((…)))).)((.((((((((((((….)))))))))))).))…(((..(((((…….)))))….))).((..((((((((((……))))..)))))).))……..((.((((((.(((..((..((((…..(.((((((……)))))))))))..))..)))..))))))))((((((…..)))))).
RS 3 seq GAUACAUUCCGUGGUGCUGGUCGACCCGCCUCGACACUAGAUGUUGUGGUGGGGAGUGAAAAGGGAAGCCGGUGCGAAUCCGGGACUGCCCCGCAGCGGUGAGAAGGAACGACAUCGGCAUGAGCACUGGGCCCCGGCCUGGGAAGCGCCGACCAGGAAGCCCCCUCGGGGAAGCGCCUUCGAGUCCGAAGACCUGCCAGCACCGGGCCGCGGCC
RS 3 dot ……((((((.(((((((((..((((((.(((((…..))))).))))))..)………..)))))))).)…)))))((((…))))(((((……..((….))…….)))))((((.((((((((…((……((((…….(((((((……)))))))……..))))…)).)))))))).))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table