Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA043338 Similarity: 0.880 Similarity: 0.873 Similarity: 0.868
UTR: 5HSAA043338
Gene: GATAD1
MFE: -44.426
ENS: 0.825
Length: 300.
Predicted Ligands:
cobalamin - 18/20
glucosamine - 1/20
FMN - 1/20
 RS: URS00023323C3_1317122
MFE: -66.133
Ligand: cobalamin
Species: Aquimarina atlantica Cobalamin riboswitch
 RS: URS000232A6ED_1073325
MFE: -61.575
Ligand: cobalamin
Species: Salegentibacter sp. HD4 Cobalamin riboswitch
 RS: URS0000ABC09C_386415
MFE: -65.918
Ligand: glucosamine
Species: Clostridium novyi NT glmS glucosamine-6-phosphate activated ribozyme
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA043338 URS00023323C3_1317122 URS000232A6ED_1073325 URS0000ABC09C_386415
Length 300. 302. 297. 297.
Similarity - 0.880 0.873 0.868
Ensemble Norm 0.825 - - -
MFE -44.426 -66.133 -61.575 -65.918
Ligands - cobalamin cobalamin glucosamine
Gene GATAD1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 35.015 35.009 12.009
Length SE - 4. 9. 9.
Lev Distance - 139. 140. 159.
UBS 12. 17. 16. 13.
BS 0. 0. 0. 2.
ILL 4. 5. 7. 6.
ILR 6. 6. 5. 6.
H 3. 5. 4. 4.
BL 2. 3. 4. 3.
BR 2. 4. 4. 1.
UN 0.050 0.172 0.145 0.145

Sequences

Field Description
UTR seq + 25 cuaaaaccucuguaaaaaauaaagucuauuuuuuaaaaaguggggaugguauuacggcaauauaaaaucaaaauacuuuaugaacaaaucuuuucuccagauguaaacugucauauaugcacccucguauguguauguauaauuuucauucaaacgugaaacaacuuuagaauuggcaccaaacauauaaacacugauacauuagacuaucucgaacaccuuuuacugaccacuuugaaaacuugcuuaccuauuaagguucauucauagcugugATGCCGCTGGGCCTGAAGCCCACCT
UTR dot + 25 ……((.((.(((((((((…..)))))))))…)).))….(((((((((((………………..((((((..(((((((((…((((((((..((((((((((((((……..)))))))))……………………………………………….)))))..)))…))))).)))…………………………………))))))..)))))))))))))))))..(((((…..)))))…
RS 1 seq ACAUUCGCGCAGAAUUUUGGUUCUGAUACUCCUUGAUCAAGGGAGUUGAAGAUUAAAAGGGAAUCAGGUACAAUGAAAAAUGAAGGUAGAGAUAUGAAUAGCGAUUUUUUAAUUUUUAAUCGUAUUUCUAACAUCUGGCAUCGUAAAUCAAUAUUCCUGAGCUGUUCCCGCAACUGUAUGCUGUGUCCACAUUAAAAAAGGAUGCUUGUUGUUAAUUCUUUAUAACCACUGCUCGUUAUGGCGAUCGGGAAGGUAAACAACAAGACGCGAGCCAGGAGACCUGCCAUUAUUCGAUAUAAUCA
RS 1 dot ………((((((….))))))..(((((((…..)))))))…………((((((((((…..(((…((((((((((((((((((.(((.((((….)))).))).))))))))))…))))….))))…)))…..)))))….)))))……….((((((((………………((((((((…(((((…….(((.((((….)))).))))))))..))))))))))))).)))((((…))))……………….
RS 2 seq AAUUUCGCACAAAAUUUUGGUUCGGAAGUGAAGUUUUUCACACCGAUUAAAAGGGAAUCAGGAAACAAUAAAGUACGAAGUUAGAAAUUGGAAGUACGAACUUAGAAGUACGAAGUGAAAUACUUCUAACUUUAAAUCUCUAACCUCUAACUUUAAAAAAAGGCCUGAGCUGUUCCCGCAACUGUAAGCUAUAAAGUUUGUUGUAAAUACUUCAAAACCACUAUCUUAAUUACCAUGGGAUGGGAAGGUAAACAGCAAGACGCGAGCCAGGAGACCUGCCAAAUGACAACUAAUAAU
RS 2 dot …………..((((((.((((..(((((….))))).))))))))))((((((((((……((((((..((.((((((.(((.(((((…….((((((((……….))))))))))))).))).)))))).))..))))))……..)))))….)))))……….(((……((((((((…..((((…….((((((((…….))))))))))))….))))))))…..)))((((…))))……………….
RS 3 seq AAUAAUAUUAAAGCGCCAGAACUUAAGUUGAGUAAAUGAGGGAAUAAAGGAAACUCAAACUAGACGUUUGAGUAAGUUCGACUAACUAAAUCAUAGAUUUAAGAAGUUAAGGAAACUCAAACUAAAUGUUUGAGUAAGUUCGCCUUAACCAAAUCGUAGAUUUGGAGGCUCACUUAAGUUGACGAGGAUGGGGAGUAUCGAGAAUUCGGCGGAUGUCCCACGGUAUUUAUGUACUACCGAUAACAGUUAGCAAAUCUAAAAAGCGAUUUUUAGCACAAAUCUAACUAGGUACAUGAU
RS 3 dot ……………….(((((((((.((((…(((((((((…….((((((((…..((((((((……((((…((((((…))))))…))))……))))))))…..))))))))..)))).))))).(((((((…)))))))..)))))))))))))……….((((.((((…………))))))))…….(((((((((…(((….(((((.(((((……..))))))))))….)))……))))))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table