Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA043346 Similarity: 0.940 Similarity: 0.935 Similarity: 0.930
UTR: 5HSAA043346
Gene: GATAD2A
MFE: -95.782
ENS: 0.730
Length: 220.
Predicted Ligands:
cobalamin - 18/20
lysine - 1/20
FMN - 1/20
 RS: URS000231FAB1_1245935
MFE: -106.510
Ligand: cobalamin
Species: Tolypothrix campylonemoides VB511288 Cobalamin riboswitch
 RS: URS0002314213_1954209
MFE: -98.798
Ligand: cobalamin
Species: bacterium AM6 Cobalamin riboswitch
 RS: URS0002319363_467661
MFE: -71.043
Ligand: cobalamin
Species: Rhodobacteraceae bacterium KLH11 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA043346 URS000231FAB1_1245935 URS0002314213_1954209 URS0002319363_467661
Length 220. 219. 221. 220.
Similarity - 0.940 0.935 0.930
Ensemble Norm 0.730 - - -
MFE -95.782 -106.510 -98.798 -71.043
Ligands - cobalamin cobalamin cobalamin
Gene GATAD2A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11.005 11. 20.
Length SE - 1. 1. 0.
Lev Distance - 74. 81. 84.
UBS 11. 9. 11. 10.
BS 10. 11. 10. 13.
ILL 1. 1. 1. 2.
ILR 1. 2. 4. 3.
H 4. 4. 3. 4.
BL 10. 9. 10. 9.
BR 12. 10. 11. 10.
UN 0.132 0.064 0.118 0.127

Sequences

Field Description
UTR seq + 25 gagcgcgccccgcgccgcccgcgcagucggucggucggucgucuguccugucgccgcugccgccgccgccacagcggccgccgcgggcgccaccugagggagucgccuccgcgggacgccacaagaccugaccggacugcgccgcccgaggccgucggccgccgucagcgagggcgccgagcaacuucguucagaATGACCGAAGAAGCATGCCGAACAC
UTR dot + 25 …((.(((.((.((…..((((((((((((((((.((.((..(((((((((((((.((.(((((…….))))).)).)))).))……((((……)))).))))))))).))..)))).))))).))))))).)).)).)))))((((.((((.((…)).))))))))((..(((((.(((…))).)))))..))………..
RS 1 seq AGACUGCGCGCGCUUCGAGGUGACCCGGCGGUGCGAGCCGCGGGUUGAAACGGGAAGCCGGUGCGUCCCCACGACCACGCCGGCGCUGCCCCCGCAACGGUAGGCGGAUCGAGCCGCGGCAUCGGCCACUGUGCGUCACGCAUGGGAAGGCGCCGCGGCGGGAACGCGUCAUGCGAUCCGUCCGCGAGCCCGGAGACCGGCCUCGUGCACGGGCGUGUC
RS 1 dot …(((((.((((((((.((((((((((.(((.((((((((((.((((…(((..(((((((.(((…..)))..)))))))….)))((((……..)))).)))).))))))).)))))).))).).))))).).)))…))))))))))((….))….(((((.(((((.((((((.((((…)))).)))))).)))))))))).
RS 2 seq AGACUGCGCGCACUUCCAGGUGACCUGCGGCCCUGCCGGCAGGUUGAAACGGGAAGCCGGUGACGCGUGACAACACGCCAUGCCGGCGCUGCCCCCGCAACGGUAAGCACGUCAGUUCCAGGCAACCCGCCACUGUGCCGCAGGCAUGGGAAGGCGCCUGGACGGUGGCCUCGGGCCACCCGGCGGCGAGCCCGGAGACCGGCCCGGAAGCCUCAGGUCGC
RS 2 dot …….((((.(((((..(((.((((((((.(.(..(((.(((((…(.(((((((((((..(((((….)))))..)))))))((((((……..)))).))…….)))).).))))).))).).).))))))))))).)))))))))…(((.(.(((.(((((((.((((((…..))).)).)…)))))))..))).)..)))..
RS 3 seq CGCUAGCGAUGACGUGAUGGUUUCCGCGCCCUUCGGGGCCGGGAUGAAAAGGGAACACGGUGCGGUUCUGCCCGGCUGAAGCCGGAAUGAGCCAAAUCCGCGACUGCCCCCGCAACUGUAAGCGGAGAGCAAUGCCGAAACACCACUGGCCUGAGGGUCGGGAAGGGCGGCAAAGCGACGACCCGCAAGUCAGGAGACCUGCCAUCGGAAACGAAACUGG
RS 3 dot .(((.(((.((.(((..((.(((((..((((((..((((((((.((….((.(.(.(((…(((((…(((((….)))))…)))))….))).)..(((.(((((……..)))).).))).).))….)).).)))))))))))))..))))….).))..))).))…))).)))((((…))))((((((….)))…)))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table