Detected as a riboswitch by 11 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA043757 Similarity: 0.958 Similarity: 0.956 Similarity: 0.954
UTR: 5HSAA043757
Gene: GDI2
MFE: -34.351
ENS: 0.825
Length: 164.
Predicted Ligands:
cobalamin - 3/20
molybdenum - 3/20
glucosamine - 3/20
 RS: URS0000C43CFA_12908
MFE: -58.261
Ligand: zmp-ztp
Species: unclassified sequences ZMP/ZTP riboswitch
 RS: URS000232E64F_891968
MFE: -45.042
Ligand: cobalamin
Species: Acetomicrobium mobile DSM 13181 Cobalamin riboswitch
 RS: URS00023199CC_43989
MFE: -39.448
Ligand: cobalamin
Species: Cyanothece sp. ATCC 51142 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA043757 URS0000C43CFA_12908 URS000232E64F_891968 URS00023199CC_43989
Length 164. 165. 163. 165.
Similarity - 0.958 0.956 0.954
Ensemble Norm 0.825 - - -
MFE -34.351 -58.261 -45.042 -39.448
Ligands - zmp-ztp cobalamin cobalamin
Gene GDI2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.001 4. 2.
Length SE - 1. 1. 1.
Lev Distance - 52. 56. 60.
UBS 13. 14. 12. 12.
BS 0. 0. 0. 0.
ILL 2. 3. 2. 2.
ILR 3. 2. 3. 2.
H 4. 5. 3. 4.
BL 4. 5. 5. 4.
BR 4. 5. 5. 4.
UN 0.140 0.103 0.123 0.152

Sequences

Field Description
UTR seq + 25 gaagcccccggaagccuccccagaagcuguugccggugcuaugcgaccuguacagccugcagaaccaaagauccaugguccaauauaacauaucuucuucaaguauuuaugggguaacaucccaaaauaacacuuuuagATGAATGAGGAGTACGACGTGATCG
UTR dot + 25 ………(((….))).(((..((((.(((.(((((…)).))).))))))))))..(.((((……..)))).)…….(((.(((((((((..((((((((((((…))))))…………))))))..)))))))…)).)))….
RS 1 seq UACAGGGUACGCAACUGGCGAUAGGAGCCUGGCAUUCGCAAACUUCUGCGAGCCAACUCUGACGUGGAAAUGGGUGGGCUUGUUCCCUUCCUCAACCACUGGGGAGCGUGCACCUUGUACUGGUGUUUGGGUUCAAGGUUUCAGCCGUUCGCCUGGGCAGCCCAU
RS 1 dot ………(((…..)))…((((..((((..(((((……))))))))).))))…((((….(((.(((……))).)))….)))).((.(((((.((((((((.(((.(….).))).))))))….))))))).))((((…)))).
RS 2 seq AAAUAAUAUAGUCGUUUCGGUGUCGGGAAAUCCGGUGAAAGACCGGUGCGGCCCCGCCGCUGUAACCCCGAUGAAAUCGCAGGUUUGCCACUGCCUUUUGGUGGGAAGGCGCGAAAGUAAGAUGAAGGGAAGCCAGAAGACCGGCCGAAAUGCGUGAGUGCUA
RS 2 dot ………….(((.(((((.((((….(((((…..)))))……)))).))))).)))((((((…))))..))…(((((.((.(((((((.((..(((…………………)))……)).))))))).))))).))….
RS 3 seq UACAAUGCAAAAAAUAUCGGUUCUAGUGGACAGCAGCCACUAGAAGUAAUGGGGAAAGUUCGGUGUAAAUCCGUCGCUGUCCCGCAACUGUGAUGAGACGUUUCAACUUCUCUUAGGGGUAAAGUUAACGAAGCUAGAAAAAACUGCCAUCUAAUAUUAGUUGAU
RS 3 dot ………………(.(((((((((.(….)))))))))).)..((((((.(((.(((…….)))..))).)))).))..(((……)))..((((((….((((((((..((((……………))))))).)))))….)))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table