Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA043771 Similarity: 0.964 Similarity: 0.961 Similarity: 0.960
UTR: 5HSAA043771
Gene: GDNF
MFE: -43.853
ENS: 0.911
Length: 142.
Predicted Ligands:
cobalamin - 15/20
molybdenum - 2/20
glycine - 1/20
 RS: URS0002331D87_1678637
MFE: -50.852
Ligand: cobalamin
Species: Streptomyces caatingaensis Cobalamin riboswitch
 RS: URS0000AB7A14_176279
MFE: -19.623
Ligand: glycine
Species: Staphylococcus epidermidis RP62A Glycine riboswitch
 RS: URS0000C595F3_1536651
MFE: -38.144
Ligand: lysine
Species: Desulfosporosinus sp. Tol-M Lysine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA043771 URS0002331D87_1678637 URS0000AB7A14_176279 URS0000C595F3_1536651
Length 142. 142. 143. 142.
Similarity - 0.964 0.961 0.960
Ensemble Norm 0.911 - - -
MFE -43.853 -50.852 -19.623 -38.144
Ligands - cobalamin glycine lysine
Gene GDNF - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9.003 11.001 10.
Length SE - 0. 1. 0.
Lev Distance - 45. 48. 50.
UBS 7. 6. 7. 7.
BS 3. 5. 2. 0.
ILL 2. 1. 0. 2.
ILR 2. 2. 1. 2.
H 3. 2. 3. 3.
BL 1. 2. 3. 1.
BR 1. 2. 2. 0.
UN 0.169 0.225 0.196 0.183

Sequences

Field Description
UTR seq + 25 ggccaaaagucuccaagucccugcuaacuucuugcucucgcaacagaauaccuauuuaggugggaagaaugaggugugggcggcaggcugggugccgccgccggacgggacuuuaagATGCCAGAGGATTATCCTGATCAGT
UTR dot + 25 (((…..((((..(((((((..(..(((((((..((((((………………))))))..)).)))))..)((((((.(((…..)))))))))….)))))))..)))))))..((((…))))…….
RS 1 seq GCCGCGCCACUAGAUGUAUGCUCGUCCUCGCUGUCGCCGCAGGGGAAUCCGGUGGAAAUCCGGAACUGUCCCGCAACGGUGUACGUGUGGGCGCAUACCGCCCCGCCGCAGUCCGAGGACCUGCCGACAGUACGCCCGCGCC
RS 1 dot …((((…….(((..((..((((((((((((((((..(((((.(((((…….)))))….)))).)..)))))…(((.(((((…..)))))))).))))..)))))))..))..)))……..)))).
RS 2 seq UUGAUCAGUAUUAGAGAGAAUAGAGAUCAAAACUUGAAUCAUUAUAAGUUAAACGUUUUUAGUCUAUUACAAUUUUGACUCUCUAUCGCCGAAGGUGCAAGUGAAAUAACGAAACUCUCAGGCAAAAGGAUAAUACUGUAACG
RS 2 dot …..(((((((((((((.(((((((((((((.((((((.((((……………))))..))).))))))))).)))))))((((…))))…((……))….)))))………..))))))))…..
RS 3 seq CAAAGUUGUAAAGGUUUACGUAAGACCGUAGCUUUGGUGAAAGGGGUAGAUGCCGAAGUUGGUUCCAAUUACGUAGGGACUGGGCUGGUUGAACAAAAUAAGAUUUGUUCAACUGUCGCGUUUGCGGAGAGCUAUCUAUAUU
RS 3 dot …………….((((((((((((..((((((((………….)))))))))))))….))))))).((((..(((.(((((((((((……))))))))))))))..))))….(((….)))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table