Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA043805 Similarity: 0.954 Similarity: 0.954 Similarity: 0.953
UTR: 5HSAA043805
Gene: GEM
MFE: -55.416
ENS: 0.974
Length: 159.
Predicted Ligands:
Mg2+ - 12/20
cobalamin - 4/20
FMN - 3/20
 RS: URS0000AB6E4A_1003200
MFE: -61.399
Ligand: FMN
Species: Achromobacter xylosoxidans AXX-A FMN riboswitch (RFN element)
 RS: URS0000C0D518_1147128
MFE: -50.582
Ligand: Mg2+
Species: Bifidobacterium asteroides PRL2011 M-box riboswitch (ykoK leader)
 RS: URS0000D8CDFE_1341694
MFE: -57.517
Ligand: Mg2+
Species: Bifidobacterium indicum LMG 11587 = DSM 20214 M-box riboswitch (ykoK leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA043805 URS0000AB6E4A_1003200 URS0000C0D518_1147128 URS0000D8CDFE_1341694
Length 159. 158. 159. 160.
Similarity - 0.954 0.954 0.953
Ensemble Norm 0.974 - - -
MFE -55.416 -61.399 -50.582 -57.517
Ligands - FMN Mg2+ Mg2+
Gene GEM - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.001 13.003 21.
Length SE - 1. 0. 1.
Lev Distance - 60. 57. 54.
UBS 8. 7. 7. 6.
BS 5. 5. 7. 8.
ILL 1. 1. 2. 2.
ILR 2. 1. 1. 1.
H 3. 3. 2. 2.
BL 4. 4. 6. 6.
BR 3. 3. 4. 4.
UN 0.170 0.196 0.220 0.156

Sequences

Field Description
UTR seq + 25 cggcggcugcaggcggcgggcaaggacggcgggcacagcgcagcacuccccgcucguuggcccggguaucccagcgcggacccacgcgauacgcugacgccccgacgccgauccggccgagccaagacucaacgATGACTCTGAATAATGTCACCATGC
UTR dot + 25 .((((((((..((((.(((((..(((…(((((.(((((.(((…….)))))))))))))….)))(((((((……)))…..))))..)))).).))))….)))))..)))……….(.((((……….)))).)….
RS 1 seq GUACGUCUUCAGGGCGGGGCGAAAUUCCCCACCGGCGGUAUGCCAAGCAAUUUGGCGAGCCCGCGAGCGCCCGGCGUCCUUCACGGAGGACACCGGGGUCAGCAGAUCUGGUGAGAUGCCAGAGCCGACGGUCACAGUCCGGAUGAGAGAAGAUGUGC
RS 1 dot ((((((((((….(.((((……..((..(((((((.((((((…..)))))).))).((..((.(((((.((((((….)))))).)))))))..))…((((((…..))))))))))..))…..)))).)……))))))))))
RS 2 seq UUGGGUGGUCGGUAGGUGAAGCUACCGCAUGGACAAGGCAUGCUGCCGCAAAGUGGUGGAGACACCCCGCGCAGGUCAACAGUCCCCGUCGGGUCAAGGCAGGGACUAAUGCAGGGCCAAAUACCAUGCGAAGCCGAAGCUUGAACGAUGACAAUGGUC
RS 2 dot ….((.((((.(((((…(((..(((((((….(((.(((((.(((…(.((((….))))).))))))..((..((((((.(((…….))).))))))..))))..)))…..))))))).)))….)))))..)))).))…….
RS 3 seq UAUGGUCAGUCGGUAGGUGAAGCUACCGCAUGGACACGGCCUGCUGCCGCAAAAUGGUGGAGACACCCUGCGCAGGUCAACAGUCCCCGUCGGAUCAAGGCUGGGACUAAUGCAGAGCCAAAUGCCAUGCGAAGCCGAAGCUUGAACGAUGACGACCCAG
RS 3 dot …((((.((((.(((((…(((..(((((((.((.(((((((((.((((….((((….)))).)))))))..((..((((((.(((…….))).))))))..))))).)))…))))))))).)))….)))))..))))…))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table