Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA043808 Similarity: 0.960 Similarity: 0.959 Similarity: 0.957
UTR: 5HSAA043808
Gene: GEMIN4
MFE: -60.110
ENS: 0.786
Length: 144.
Predicted Ligands:
cobalamin - 9/20
FMN - 8/20
TPP - 2/20
 RS: URS0000AB69B7_887898
MFE: -48.865
Ligand: TPP
Species: Lautropia mirabilis ATCC 51599 TPP riboswitch (THI element)
 RS: URS000232A247_324602
MFE: -48.942
Ligand: cobalamin
Species: Chloroflexus aurantiacus J-10-fl Cobalamin riboswitch
 RS: URS000233030A_1415544
MFE: -52.370
Ligand: cobalamin
Species: Streptomyces sp. MMG1121 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA043808 URS0000AB69B7_887898 URS000232A247_324602 URS000233030A_1415544
Length 144. 143. 143. 142.
Similarity - 0.960 0.959 0.957
Ensemble Norm 0.786 - - -
MFE -60.110 -48.865 -48.942 -52.370
Ligands - TPP cobalamin cobalamin
Gene GEMIN4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 15.004 8.002 3.
Length SE - 1. 1. 4.
Lev Distance - 47. 51. 52.
UBS 5. 8. 7. 5.
BS 7. 5. 6. 8.
ILL 0. 0. 1. 1.
ILR 2. 3. 2. 1.
H 2. 2. 2. 2.
BL 5. 6. 6. 5.
BR 4. 4. 5. 4.
UN 0.153 0.217 0.112 0.169

Sequences

Field Description
UTR seq + 25 aggccuaagcgcggccgccguggcuccugcgucucccaucgugccgugcgucccgcgccgcguucgaguucucggaggggagggggcguuagccccgcgcagccgccggcgucgccgccATGGACCTAGGACCCTTGAACATCT
UTR dot + 25 (((.(((.(.((((((((((((((…((((((((((.((((((.(((((…))))).)))……….)))..)))))(((((….)))))))))))))).)))))..)))))).))).)))……………..
RS 1 seq GUCCGUUCCUGGGGGAGUCCUACCCGAUGGCGCAUCGGCACCUGCCGUGCCUUGCCAUCCAAGGACUGAGAGUCGGCCACUGGCCAAGACCCUUAGAACCUGAUCCGGAUCAUGCCGGCGAAGGGAAGGAAAUCGCAUGCAGA
RS 1 dot .(((.(((((((.(..((((…..(((((((((.((((….)))))))…))))))(.(((.(((((.(((((((…))))..))).)))))..))))….))))..).)))).))).)))……………..
RS 2 seq ACAAGUUCAUAUCGUCGCGGUGACCCGUUGGCCCGGAUGCCAGGGCGUAAAGGUGGAAGCUGGUGCAAGUCCAGCGCUGUGCCGCAACUGUAACCGGUUAGAAAGCCGGAAGCCAGGACGCCUGCCGCGAUGUGAUGAUGUUC
RS 2 dot (((…(((((((((.((((((.((…((((.(((.(((((.(((((…..((((.((….))…))))))))).))..))).)))…((((((….))))))..)))))).)))).)).)))))))))…)))..
RS 3 seq AGCCCGGCACUAGAUGUAUGCUCGUCCUCGCUGUCGUCGCAGGGGAAUCCGGUGCGAAUCCGGAACUGUCCCGCAACGGUGUACUUGUGCGUGUCUGCGCACAGGAGUCAGUCCGAGGACCUGCCGCCAGCGCGCGCCCGGC
RS 3 dot .(((.(((.(..(.((…((..((((((((((((((.((.((((..(((((…….)))))….)))))).))))….(((((((((….)))))))))…)))..)))))))..))…)).)..).))).)))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table