Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA043806 Similarity: 0.939 Similarity: 0.939 Similarity: 0.939
UTR: 5HSAA043806
Gene: GEM_0
MFE: -65.712
ENS: 0.985
Length: 180.
Predicted Ligands:
cobalamin - 17/20
FMN - 2/20
SAM - 1/20
 RS: URS000232F423_1616823
MFE: -57.187
Ligand: cobalamin
Species: Thalassospira sp. HJ Cobalamin riboswitch
 RS: URS0002329E0E_1505936
MFE: -68.310
Ligand: cobalamin
Species: Mesorhizobium sp. ORS3428 Cobalamin riboswitch
 RS: URS0000AB2ADA_357808
MFE: -68.550
Ligand: SAM
Species: Roseiflexus sp. RS-1 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA043806 URS000232F423_1616823 URS0002329E0E_1505936 URS0000AB2ADA_357808
Length 180. 180. 179. 181.
Similarity - 0.939 0.939 0.939
Ensemble Norm 0.985 - - -
MFE -65.712 -57.187 -68.310 -68.550
Ligands - cobalamin cobalamin SAM
Gene GEM - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4. 5.002 18.004
Length SE - 0. 1. 1.
Lev Distance - 80. 78. 72.
UBS 11. 12. 12. 12.
BS 4. 3. 3. 2.
ILL 1. 1. 2. 3.
ILR 3. 3. 4. 4.
H 5. 4. 5. 3.
BL 4. 5. 4. 2.
BR 4. 4. 3. 4.
UN 0.106 0.122 0.061 0.039

Sequences

Field Description
UTR seq + 25 ugguuauaaaccgcccggccgcggcggcugcaggcggcgggcaaggacggcgggcacagcgcagcacuccccgcucguuggcccggguaucccagcgcggacccacgcgauacgcugacgccccgacgccgauccggccgagccaagacucaacgATGACTCTGAATAATGTCACCATGC
UTR dot + 25 .((((…))))(((((((((…))))))..)))(((.(((..(((((((((((.(((((.(((…….)))))))))))((((…..(((((((……)))…..))))….)))).))))).))).)))..)))……….(.((((……….)))).)….
RS 1 seq GCAGGUGCUAUAAACCGCCAUGUCGCGAAUGUGACCGGAAAACAUGGUCGGGAAUCCGGUGCGGCCCUGCGUUAAAGCAGUGUUGCCAAGCCCGGAACUGCCCCCGCAACUGUAAGCGCAAAGGCCUUAUUUGCAGGUUUUCUCGCGAGUCAGAAUACCGAUGGUGUUUUCUUGGCAUGA
RS 1 dot ((.(((…….)))))(((((((………..(((((((((.(((((…(((((.((((((((((……)))).)..)))..)))))))…(((..(((……..)))….)))((.((((((.((….)).)))))).))….))))).)))))))))))))))).
RS 2 seq AAGGUCGUAUCGCUGCCUGGUGCCCGCAACACGCGGGAGAAUCGGGAACACGGUUGAAUUCCGUGGCGUGCCCAACGCUGUGAGGGGGACCGCGCCGGCAAAAGCCACUGUCCAAGACGGGAAGGCGCCGGAGCGGGUUGAUCCCGAGCCAGAAGACCGGCCCGGCAGACAUGGUCGUC
RS 2 dot ..(((((..((.(((((((((.(((((…..)))))…))))))..(((((…….)))))((((…..)))).((..((((((((((.(((((….(((.(((((…)))))…)))))))).)))).))..))))..)))))..)).)))))((((…….))))..
RS 3 seq CUCUUAUCCAGAGAGGCGGAGGGACCGGCCCGAUGAAGCCUCGGCAACCUCCGGUGCAGGGUAAGACGUUCAGGUGCUGAGACUGGCGUCAGUGACGAUGCCUCCUCACUCCAGGCAACCUGAGCAUCUUGUUCACACUGGAAGGUGCCAAUUCCGGCAGAGUAUAUCUGGAAGAUGAGAG
RS 3 dot ((((((((((((((((((..(((…..)))..)…)))))(((.((((((((((..((((((((.((((((((((((((…((((((……))))))..))))……))).))))))).)))))))).))))))).)))))).((((…..))))…))))))…))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table