Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA044010 Similarity: 0.977 Similarity: 0.977 Similarity: 0.976
UTR: 5HSAA044010
Gene: GGPS1
MFE: -29.960
ENS: 0.945
Length: 109.
Predicted Ligands:
TPP - 8/20
guanidine - 4/20
homocysteine - 2/20
 RS: URS0000D87FD0_1122133
MFE: -55.931
Ligand: guanidine
Species: Kaistia soli DSM 19436 Guanidine-I riboswitch
 RS: URS0000D8CDE7_192843
MFE: -38.138
Ligand: homocysteine
Species: Albidiferax ferrireducens S-adenosyl-L-homocysteine riboswitch
 RS: URS0000BF6990_1637645
MFE: -25.194
Ligand: glutamine
Species: Limnoraphis robusta CS-951 Glutamine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA044010 URS0000D87FD0_1122133 URS0000D8CDE7_192843 URS0000BF6990_1637645
Length 109. 109. 110. 108.
Similarity - 0.977 0.977 0.976
Ensemble Norm 0.945 - - -
MFE -29.960 -55.931 -38.138 -25.194
Ligands - guanidine homocysteine glutamine
Gene GGPS1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6. 11. 8.
Length SE - 0. 1. 1.
Lev Distance - 28. 25. 28.
UBS 9. 8. 8. 9.
BS 0. 0. 0. 0.
ILL 3. 3. 3. 1.
ILR 1. 1. 1. 1.
H 2. 2. 2. 2.
BL 3. 2. 2. 5.
BR 5. 3. 2. 5.
UN 0.110 0.092 0.127 0.130

Sequences

Field Description
UTR seq + 25 cgcgcaaauccucguccgcgagaacugcaaggcccgcaaugcccugcgccugcguggaccgauuagcuuugaaguuuaaauccaATGGAGAAGACTCAAGAAACAGTCC
UTR dot + 25 …((.((((…(((((((((…((((.(((…….))).)))).)).))))))).)))).))((((.(((((…(((…)))..)))))))))………
RS 1 seq UGAGUUGGUGGCUAGGGUUCCGGUUCCCGCGAGGGAGCGCUGGUCCGAGAGCUGCCGCCGGCGCGGGAGACAUCCGCGCCGGGCACGGCGGGAUAAAAUCCCGGGAGAC
RS 1 dot …(((((((((…((((((((..((.(((……))).)).))).)))))))))))))).(((((…((((.(((((….)))))))))….)))))……
RS 2 seq CAGUUCGAGGAGCGUUGCAGCUCACAUGGGUGGCCAGGCCAUCGUGCUGAGUGAGGCUCGGACCCCGCUGUUGUUUUUAACGCAGCGUUUCACAACGGCGCUCACCCACG
RS 2 dot ..((((…((((.((…((((((((.((((((…))))))))).))))))).))))))))..(((((((((….((((…))))..)))))))))……….
RS 3 seq AACGUUCAUCUCUCGGAUCUAGAGAACGCUGAUCUCAGUAAAGUCAGGAAAAUCAUCGAGAUCAGAGAGACGGAAGUAGGGAAAUCAUCAUUCCUGAAGGAACGCGCC
RS 3 dot ..(.(((.((((((.(((((.((((…((((.((……))))))…..)).)).))))).)))))).))).)((((((……..))))))…………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table