Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA044078 Similarity: 0.951 Similarity: 0.949 Similarity: 0.948
UTR: 5HSAA044078
Gene: GHITM
MFE: -67.110
ENS: 0.958
Length: 174.
Predicted Ligands:
cobalamin - 7/20
lysine - 6/20
Mn2+ - 3/20
 RS: URS0000C09E2A_1678637
MFE: -73.564
Ligand: Mg2+
Species: Streptomyces caatingaensis M-box riboswitch (ykoK leader)
 RS: URS0002332B42_1840095
MFE: -66.763
Ligand: cobalamin
Species: Streptomyces sp. F-3 Cobalamin riboswitch
 RS: URS0000AB3F83_471855
MFE: -67.903
Ligand: lysine
Species: Slackia heliotrinireducens DSM 20476 Lysine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA044078 URS0000C09E2A_1678637 URS0002332B42_1840095 URS0000AB3F83_471855
Length 174. 174. 171. 173.
Similarity - 0.951 0.949 0.948
Ensemble Norm 0.958 - - -
MFE -67.110 -73.564 -66.763 -67.903
Ligands - Mg2+ cobalamin lysine
Gene GHITM - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.003 10.001 15.
Length SE - 0. 9. 1.
Lev Distance - 63. 50. 60.
UBS 12. 13. 14. 14.
BS 2. 2. 0. 0.
ILL 1. 2. 2. 3.
ILR 2. 1. 3. 3.
H 5. 5. 5. 5.
BL 5. 7. 5. 4.
BR 6. 6. 6. 5.
UN 0.040 0.098 0.076 0.035

Sequences

Field Description
UTR seq + 25 acguccuuucgauguugcgucaugcagugcgccggaggaacugugcucuuugaggccgacgcuaggggcccggaagggaaacugcgaggcgaaggugaccggggaccgagcauuucagaucugcucgguagaccuggugcaccaccaccATGTTGGCTGCAAGGCTGGTGTGTC
UTR dot + 25 (((((…..)))))..((((.((((((.(((.(……).)))((((((..((((………))))..))))))..)))))).))))..((((((((((.((((((((………))))))))…)))))).))))((((((((.(((….))).).))))).)).
RS 1 seq GAGGCACCUCGUUCGGUGAGGCGUCUGUACGGACACAGGCCACUGACCCCACGACGUCGAGAGACGCCCAGGGUCAGGACAGAUCUCCCCGGCUCAAGGGGUGAUCCCAAGUGGCUUCCCGCGCCAGGGGAUUACGCCGUGCAGUGCCAAAGCUCUGACGAGUCGGGGUGAACC
RS 1 dot ….((((……)))).(((.(.(((….))).).))).(((((((…(.((((….)))))…)))))))……((.(((((((((..((.((((((((…((((…….)))).)))))))).))((.(((.((….)).)))))))))))))).))…
RS 2 seq GGGGUGUCUCCCCGUCCCGGCACAACAUGUAUGCUCAUGCUCGCUGUCGCCGCAGGGGAAUCCGGUGCGAAUCCGGAACUGUCCCGCAACGGUGUAUUCGCACGCGUGUGCCCGUAUGGCCGUGUACAUGCGUGCGUCAGUCCGAGUACCUGCCGACAGUGCACCCGGCCG
RS 2 dot ((((…..))))….((((….((((……))))…)))).(((((..(((((.(((((…….)))))….)))).)..)))))….(((((((((((((.((……)).)))))))))))))…(.(((.((.((((….))).).)).))).).
RS 3 seq AAUCCUGAUAGAGGAGCUUCUCGGCAUUCCCGACGGACACACGGGACGAAUUGCCCGCCGUCGCGAGGGAAGGCCAGAAGCCGAAGGGACCAGCAAGAAUUCGAUUGCCGCUCCUUGGGACGUCGGAGAACAUCCGGCGGACUGUCACAGUGAUGUGGAGCGCUAUCGUGAUU
RS 3 dot ..((((…..))))((((((.(((.(((((..(((((…((((……..))))..))).)).))))).)))))))))…(((((.(.((((……..)))).).)))))((..(((((((…..)))))))..))(((((((((……..))))…))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table