Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA044081 Similarity: 0.972 Similarity: 0.972 Similarity: 0.972
UTR: 5HSAA044081
Gene: GHITM_0
MFE: -42.054
ENS: 0.944
Length: 111.
Predicted Ligands:
SAM - 13/20
glycine - 6/20
cobalamin - 1/20
 RS: URS0000C58319_1415775
MFE: -26.930
Ligand: glycine
Species: Clostridium baratii str. Sullivan Glycine riboswitch
 RS: URS0000C6CD14_79884
MFE: -27.622
Ligand: SAM
Species: Bacillus pseudalcaliphilus SAM riboswitch (S box leader)
 RS: URS0000C5CB5A_1679169
MFE: -38.945
Ligand: SAM
Species: Bacillus sp. FJAT-27916 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA044081 URS0000C58319_1415775 URS0000C6CD14_79884 URS0000C5CB5A_1679169
Length 111. 111. 111. 110.
Similarity - 0.972 0.972 0.972
Ensemble Norm 0.944 - - -
MFE -42.054 -26.930 -27.622 -38.945
Ligands - glycine SAM SAM
Gene GHITM - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 12. 8. 12.
Length SE - 0. 0. 1.
Lev Distance - 32. 34. 31.
UBS 11. 9. 10. 11.
BS 0. 0. 0. 0.
ILL 2. 3. 2. 2.
ILR 1. 2. 2. 2.
H 4. 3. 3. 3.
BL 2. 3. 4. 5.
BR 5. 3. 4. 4.
UN 0.063 0.063 0.081 0.073

Sequences

Field Description
UTR seq + 25 gugcucuuugaggccgacgcuaggggcccggaagggaaacugcgaggcgaaggugaccggggaccgagaccuggugcaccaccaccATGTTGGCTGCAAGGCTGGTGTGTC
UTR dot + 25 …(((…)))(((..(((.((…(((….)))…))))).)))…((((((((((……..)))))).))))((((((((.(((….))).).))))).)).
RS 1 seq GGACGAGCCUCUGGAGAGACCUAAAGAGUUUACUUUAGGCACCGAAGGAGCAAGACAUAUAAAUUAAUUUAUAUGUUGAAACUCUCAGGUAAAAGGGACAGGGGAUUUUUU
RS 1 dot ….(..(((.(((…(.(((((((……)))))))).))).)))..)..((((((((((….))))))))))((((.((((..((…….))..)))).)))).
RS 2 seq CUCUUAUGUUGAGUGGUGGAGGGACUGGCCUGAUGAAACCCAGCAACCGUUUUCGUUUAGAAAAUUGGUGCUAAUUCCUGCGAAUCUAGAAGUAGAUUCGAGAGAUAAGAG
RS 2 dot ……(((((.((..((..(((…..)))..))..)).)))))(((((((((…..)))))).))).((.(((.((.((((((((….)))))))))).))).))..
RS 3 seq AACUUAUCGAGAGUGGCGGAGGGACUGGCCCGUUGAAGCCCGGCAACCGGUAUCACUAAAUGUGAUGCACGGUGCUAAAUCCUGCGGAAUCAUAUUCCGGGAGAUAAGGC
RS 3 dot ……(((.(.((..(((.(((…..))).)))..))))))..(((((((((((…..))))))).))))(((..(((.(.((((((…)))))).).)))..)))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table