Detected as a riboswitch by 12 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA044087 Similarity: 0.962 Similarity: 0.962 Similarity: 0.960
UTR: 5HSAA044087
Gene: GHITM_1
MFE: -48.197
ENS: 0.872
Length: 153.
Predicted Ligands:
molybdenum - 8/20
cobalamin - 6/20
glycine - 4/20
 RS: URS0000ABA20F_391574
MFE: -44.377
Ligand: molybdenum
Species: Vibrionales bacterium SWAT-3 Moco (molybdenum cofactor) riboswitch
 RS: URS0000ABC04E_768704
MFE: -42.563
Ligand: molybdenum
Species: Desulfosporosinus meridiei DSM 13257 Moco (molybdenum cofactor) riboswitch
 RS: URS000232E498_211114
MFE: -61.897
Ligand: cobalamin
Species: Kibdelosporangium albatum Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA044087 URS0000ABA20F_391574 URS0000ABC04E_768704 URS000232E498_211114
Length 153. 153. 154. 154.
Similarity - 0.962 0.962 0.960
Ensemble Norm 0.872 - - -
MFE -48.197 -44.377 -42.563 -61.897
Ligands - molybdenum molybdenum cobalamin
Gene GHITM - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 12.005 12.001 7.014
Length SE - 0. 1. 1.
Lev Distance - 46. 45. 49.
UBS 10. 11. 11. 12.
BS 0. 0. 0. 0.
ILL 2. 1. 1. 1.
ILR 1. 2. 2. 2.
H 3. 5. 4. 3.
BL 3. 4. 5. 3.
BR 5. 3. 3. 6.
UN 0.157 0.085 0.130 0.039

Sequences

Field Description
UTR seq + 25 agggaaacugcgaggcgaaggugaccggggaccgaguagguuguuuuacuuauguuuuuuugguugguuuugccuuuuuuuuaaacuagcauuucagaucugcucgguagaccuggugcaccaccaccATGTTGGCTGCAAGGCTGGTGTGTC
UTR dot + 25 ………..(((((((((.((((((((((….((((((……))))))…)))))))))).)))))))))…………((((..(((.(((((…))))).)))))))(((((((((.(((…..))).)).))))).)).
RS 1 seq CGGUUGCCAUAACUCCGAGCUCUCGCAUGCUAAGUCGCACAGUGGUAUUUGCUGUACCGAUACGCAUCAAGAGCCAGUGACAUGUUGUCACAAGGGCUUAAUUGGAAAUGAUUAUGCCUCCCGUGUUUGGAAAGGUGUUCCGUGGCGCAACAA
RS 1 dot (((………..))).(((((.(.((((…((((.((((((…..))))))..))))..))))).)))))..((((((…))))))..((((.((((((….)))))).))))…((((((((((…..))))).)))))…..
RS 2 seq AUAAUAAGUCUUUUCCGCGUUCUGACCGCUAAAAGCGACUGCUCUAAGCCAGUUCAUGCUGUCAGAACCUGAGUCUGAACCUUACAGACUCACAGGGUUAUGAUUGGAAACGAUAUAACCUUCACUUUUGAGAAGGAAAAGCUGCGGCAGAAGA
RS 2 dot …………….(.((((((((.((…….(((((((…))).))))…)).)))))))))((((((((…….)))))))).((((((((.((((….))))))))))))..((((((.(.((……)).)..)))))).
RS 3 seq AAUCCGCACCGUCGCGGUGUUUUCCCACUGUGUGUGAUGAUGCUGGGGACGACGCAAGGGGAGCGCGAGGAAACCGGUGCGAAUCCGGUGCGGUCCCGCCACUGUGACCGGAGCGAUCCGGGAGCCAGGAACUCAACCCCCUUGCCGGGUGCGC
RS 3 dot ….(((((((((((((((((.((((.(.((((……)))).))))).)))))……..)))))……)))))))..(((((((((((……))))).))))))((((((((((((…((……..)).))).)))))).)))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table