Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA044098 Similarity: 0.988 Similarity: 0.987 Similarity: 0.987
UTR: 5HSAA044098
Gene: GHRH
MFE: -19.521
ENS: 0.703
Length: 62.
Predicted Ligands:
fluoride - 15/20
unknown - 3/20
glutamine - 2/20
 RS: URS00008FED37_32046
MFE: -21.917
Ligand: glutamine
Species: L-glutamine riboswitch (58-MER) from Synechococcus elongatus (PDB 5DDO, chain B)
 RS: URS0000DA4003_1121425
MFE: -18.535
Ligand: fluoride
Species: Desulfotomaculum australicum DSM 11792 Fluoride riboswitch
 RS: URS0000D96571_243061
MFE: -15.948
Ligand: fluoride
Species: Mycobacterium sherrisii Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA044098 URS00008FED37_32046 URS0000DA4003_1121425 URS0000D96571_243061
Length 62. 61. 62. 61.
Similarity - 0.988 0.987 0.987
Ensemble Norm 0.703 - - -
MFE -19.521 -21.917 -18.535 -15.948
Ligands - glutamine fluoride fluoride
Gene GHRH - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.010 7.007 3.018
Length SE - 1. 0. 1.
Lev Distance - 15. 15. 16.
UBS 4. 3. 5. 3.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 0. 0. 1. 0.
H 2. 2. 3. 2.
BL 2. 1. 0. 1.
BR 1. 1. 1. 0.
UN 0.177 0.279 0.097 0.311

Sequences

Field Description
UTR seq + 25 ggauaucugccgcaucaggugccaccccgggugaaggATGCCACTCTGGGTGTTCTTCTTTG
UTR dot + 25 .(.((((((……)))))))(((((.(((((……..))))).)))))……….
RS 1 seq CGUUGGCCCAGGAAACUGGGUGGAAGUAAGGUCCAUUGCACUCCGGGCCUGAAGCAACGCU
RS 1 dot ..((.((((((….)))))).))….((((((……….))))))………..
RS 2 seq CUGCUCCAUGGCGAUGGAGCUCGCCUGGAAUGCCCGGAAAGGCUGAUGGCUCCUACCAAAAU
RS 2 dot ..(((((((….)))))))((((((((…..))….)))).))(((……)))….
RS 3 seq UCGCUGACAGGUGAUGAGGCUCACCUUCAACCGCCAUACGGCUAAUGGCUUCUACCCACUG
RS 3 dot ….(((.((((((……)))))))))…(((((…….)))))…………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table