Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA044141 Similarity: 0.968 Similarity: 0.967 Similarity: 0.967
UTR: 5HSAA044141
Gene: GIMAP4
MFE: -35.544
ENS: 0.985
Length: 124.
Predicted Ligands:
cobalamin - 6/20
TPP - 5/20
glycine - 3/20
 RS: URS0000C0D99F_1684385
MFE: -45.642
Ligand: TPP
Species: Novosphingobium sp. ST904 TPP riboswitch (THI element)
 RS: URS0000C49759_927661
MFE: -55.157
Ligand: TPP
Species: Cryptosporangium arvum DSM 44712 TPP riboswitch (THI element)
 RS: URS00009C8493_1747903
MFE: -40.846
Ligand: zmp-ztp
Species: Janthinobacterium sp. S3-2 pfl RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA044141 URS0000C0D99F_1684385 URS0000C49759_927661 URS00009C8493_1747903
Length 124. 123. 125. 123.
Similarity - 0.968 0.967 0.967
Ensemble Norm 0.985 - - -
MFE -35.544 -45.642 -55.157 -40.846
Ligands - TPP TPP zmp-ztp
Gene GIMAP4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8. 6.003 9.008
Length SE - 1. 1. 1.
Lev Distance - 38. 40. 39.
UBS 10. 9. 12. 11.
BS 0. 0. 0. 0.
ILL 2. 3. 2. 3.
ILR 4. 2. 4. 3.
H 2. 1. 2. 3.
BL 6. 5. 7. 4.
BR 4. 4. 3. 3.
UN 0.129 0.146 0.072 0.041

Sequences

Field Description
UTR seq + 25 agguaagggaauagggguguguguggugggggucgggacgaaugugcgauuuuggugaggagggaccuguaucuuaaaucgucuggaguucaagcgacaATGGCAGCCCAATACGGCAGTATGA
UTR dot + 25 ………….(((.(((.(((.((.(((.((.((((((……(((…(((……..)))…)))…..)))))).)).)))..)).)))…))).))).((((….))))..
RS 1 seq CUUCAACCCACGGGGUGUCCUGGCGCUGUCCGGGCUGAGAGGCGGAUCGGGGCCGUUCCCAGUCCGCAAACCCGCGAACCUGAUCCGGCUCAUACCGGCGGAGGAAUAGGGACAUGCACUGCU
RS 1 dot …………(.(((((((..(.(((.((((..((.(((.(((((((((..(((……………..)))..))))))))).))).))))))))).)…..))))))).)……
RS 2 seq GUCACUGUACGCGGGAGCUCGCGCCGGAAGCGGGCUGAGAGGGCGGCUGUCCGAGAAGGACGGUGCCGCCGACCGCUCGAACCUGACCGGGUAAUGCCGGCGUAGGGAGCUCUUCAUGAGCAAUG
RS 2 dot ….((.(((((.((.(((((.(.(((…(((((.(.(..(((((((((((…..)))))..))))))..)))))))…))).))))))….)).))))).)).((((…..))))….
RS 3 seq UACGUCUCACGUGACUGGCGAAAAGCUGCAACUGUCCCCAUUUUGGUGCGAUGAUUGCCGGCGAAAGGUGGGCAUCCACCGGGAAACGUGAGAUUUCAUCAGCCGUUCGCCUGGGCAGCCCAC
RS 3 dot …(((……))).((((((..((((…..(((.((.((((((((.((….((((.((…..)).))))))))))))))…).).)))…..))))..))))))((((…)))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table