Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA044152 Similarity: 0.978 Similarity: 0.978 Similarity: 0.977
UTR: 5HSAA044152
Gene: GIN1
MFE: -23.498
ENS: 0.950
Length: 107.
Predicted Ligands:
SAM - 19/20
glycine - 1/20

 RS: URS0000C2A2C5_1235279
MFE: -37.034
Ligand: SAM
Species: Bhargavaea cecembensis DSE10 SAM riboswitch (S box leader)
 RS: URS0000C6BAA4_1196324
MFE: -30.384
Ligand: SAM
Species: Fictibacillus macauensis ZFHKF-1 SAM riboswitch (S box leader)
 RS: URS0000AB49E0_526976
MFE: -27.089
Ligand: SAM
Species: Bacillus cereus BDRD-ST196 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA044152 URS0000C2A2C5_1235279 URS0000C6BAA4_1196324 URS0000AB49E0_526976
Length 107. 107. 108. 107.
Similarity - 0.978 0.978 0.977
Ensemble Norm 0.950 - - -
MFE -23.498 -37.034 -30.384 -27.089
Ligands - SAM SAM SAM
Gene GIN1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10. 6. 12.
Length SE - 0. 1. 0.
Lev Distance - 25. 26. 26.
UBS 9. 10. 9. 9.
BS 0. 0. 0. 0.
ILL 3. 1. 2. 2.
ILR 1. 1. 2. 2.
H 3. 3. 3. 3.
BL 2. 4. 2. 3.
BR 5. 4. 3. 2.
UN 0.178 0.168 0.157 0.187

Sequences

Field Description
UTR seq + 25 aguuccgcuuccggcagcgcgagauaaaucacgagaggaagcuuaaaucugucguuugaauuuaggaccaccucgguucacaATGGTCCGTAGTGGAAAAAATGGTG
UTR dot + 25 …….(((((..(..((.((……)).)).).)))))((((((((……..)).)))))).((((..(((.(((…))).)))..))))………..
RS 1 seq UUCUUAUCCAGAGAGACGGAGGGACUGGCCCUGUGAUGUCUCAGCAACCUGCCAUCGGCAAAGGUGCUACUUCCAGCGGAUCCUGAAAAGGUUCCGGAAGAUAAGAA
RS 1 dot ……….((((.(((.((((…..)))).)).).))))(((.(((((((…))))..)))))).(((((…(((.(((….))).))))))))…….
RS 2 seq UUCUUAUCGAGAGAGAUGGAGGGAUAUGGCCCUAUGAAGUCUCGGCAGCAGGUUUACGUAAACACUGUGCCAAAUCCAGCAAACCUAACAAGGUUUGGAAGAUAAGAA
RS 2 dot ……….((((..(.(((((……)))).).)..))))((((.(((((((….)))).)))))))..(((…(((((((….)))))))…)))…..
RS 3 seq UUCUUAUCAAGAGAGAUGGAGGGACUGGCCCGGUGAAAUCUCAGCAACAGGCUAAAAAAGCACUGUGCUAAUUCCAGCAAACGUAAAAGGCGUUUGGAAGAUGAAGG
RS 3 dot ……….((((..(.(.(((…..)))..).)..))))(((.(((((((…..))).)))))))..(((((…(((((…..))))))))))……..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table