Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA044153 Similarity: 0.972 Similarity: 0.971 Similarity: 0.970
UTR: 5HSAA044153
Gene: GIN1_0
MFE: -27.270
ENS: 0.979
Length: 120.
Predicted Ligands:
SAM - 9/20
molybdenum - 6/20
methionine - 2/20
 RS: URS0000C46B33_1231342
MFE: -37.351
Ligand: SAM
Species: Acetobacter orleanensis JCM 7639 SAM-I/IV variant riboswitch
 RS: URS0000C80BC1_1224162
MFE: -48.348
Ligand: methionine
Species: Corynebacterium marinum DSM 44953 S-adenosyl methionine (SAM) riboswitch,
 RS: URS00023142FB_1090379
MFE: -31.920
Ligand: cobalamin
Species: Burkholderia sp. BR2009044596 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA044153 URS0000C46B33_1231342 URS0000C80BC1_1224162 URS00023142FB_1090379
Length 120. 120. 120. 121.
Similarity - 0.972 0.971 0.970
Ensemble Norm 0.979 - - -
MFE -27.270 -37.351 -48.348 -31.920
Ligands - SAM methionine cobalamin
Gene GIN1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 12.003 10. 12.001
Length SE - 0. 0. 1.
Lev Distance - 32. 35. 33.
UBS 10. 9. 10. 10.
BS 0. 0. 0. 0.
ILL 3. 0. 1. 2.
ILR 1. 0. 0. 2.
H 4. 4. 4. 4.
BL 2. 2. 3. 3.
BR 5. 4. 3. 2.
UN 0.167 0.225 0.167 0.132

Sequences

Field Description
UTR seq + 25 aaaggacccggguaguuccgcuuccggcagcgcgagauaaaucacgagaggaagcuuaaaucugucguuugaauuuaggaccaccucgguucacaATGGTCCGTAGTGGAAAAAATGGTG
UTR dot + 25 ……..((((….))))(((((..(..((.((……)).)).).)))))((((((((……..)).)))))).((((..(((.(((…))).)))..))))………..
RS 1 seq UAGAAGCAUCAAGAGUCAGGCCGACGCCUGACACCAACCUGCCUCCGUGCAAGGUGGUGCCUUCCCUGUCUGACAGUGUGAAGGGAUGUGGCCAGAAGACCGGCAAUAUACGGACCCAUG
RS 1 dot ……………((((((….))))))((((.((((((……))).)))))))((((((((((…)))).).))))).((((.(((……..))).))))………..
RS 2 seq GAUCAAGAAGCUCAGCCACACGGCCCCCCGGCCGGCUGACUGGCAACCGCCACUCGUAGGACGGUGCCCCCGAGGGAAGAUCGGCCCCCGCGCGAACACGCGCCGAGGGAAGAUACGAGC
RS 2 dot ……..((.((((((….((((….))))))))))))(((.((((((…….)).))))))).((((…….))))((((.(((((….))))).).)))………..
RS 3 seq AUAAAAUGGCAAGCGCGCAGUGCGAGGAAGCCGGUGUGAAUCCGGCACGGUCGCGCCACUGUAAGCAAUUCGCUUCAUCACGACGCCGCAAGUCAGACCCUGCUGCAUGUUCUUCGUCAAC
RS 3 dot ……((((….)).))((((((….(((((…….)))))….))))))…((.((((…..))))))….((((..(((.(.(((……)))).)))….))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table