Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA044277 Similarity: 0.963 Similarity: 0.962 Similarity: 0.962
UTR: 5HSAA044277
Gene: GLA
MFE: -36.018
ENS: 1.
Length: 135.
Predicted Ligands:
cobalamin - 9/20
TPP - 4/20
molybdenum - 3/20
 RS: URS0002318E6B_1129367
MFE: -21.716
Ligand: cobalamin
Species: Pseudoalteromonas luteoviolacea S4054 Cobalamin riboswitch
 RS: URS0000C74AA8_1484158
MFE: -39.381
Ligand: molybdenum
Species: Pantoea sp. PSNIH1 Moco (molybdenum cofactor) riboswitch
 RS: URS0000AB2819_399742
MFE: -42.384
Ligand: molybdenum
Species: Enterobacter sp. 638 Moco (molybdenum cofactor) riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA044277 URS0002318E6B_1129367 URS0000C74AA8_1484158 URS0000AB2819_399742
Length 135. 135. 135. 135.
Similarity - 0.963 0.962 0.962
Ensemble Norm 1. - - -
MFE -36.018 -21.716 -39.381 -42.384
Ligands - cobalamin molybdenum molybdenum
Gene GLA - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11.007 14.005 23.009
Length SE - 0. 0. 0.
Lev Distance - 46. 47. 44.
UBS 6. 6. 8. 9.
BS 0. 0. 0. 0.
ILL 0. 2. 1. 2.
ILR 2. 3. 4. 2.
H 2. 1. 1. 1.
BL 3. 1. 3. 3.
BR 0. 1. 2. 3.
UN 0.281 0. 0.207 0.185

Sequences

Field Description
UTR seq + 25 aaacaauaacgucauuauuuaauaagucaucggugauugguccgccccugagguuaaucuuaaaagcccagguuacccgcggaaauuuaugcuguccggucaccgugacaATGCAGCTGAGGAACCCAGAACTAC
UTR dot + 25 …………………….((((.(((((((((((((((.((((.((((………))))))))……)))))…………))))))))))))))…….(((…….)))……
RS 1 seq GACUUCAUAAUACACAAAAUUAUUUCGACAUCACUUGGGAAUGAGGUGUAAACCCUCAGCUGUCCCCGCAACUGUAAAAAUGAUUGCAUGACUACUCAUUUAAAGCCAGAUACCAAGGUUGGAAUAAAGACUUAA
RS 1 dot ……………….((((((((((….((((((((((((((((((…..(((.(((….))).)))………))))))…..)))))))………..)))))))))))))))……..
RS 2 seq AAUGACAACAAACUCCCAAGCCUUGCGCGCCUAAGUCAAAUGAUAGGGCCGCCUGGCCGCAGCGUCAUGCUGCCAGGGUGCAGAAAGAAAUGCCUGCAUCUCCCGACUUUGGAAAGGUGUUAAGGUGCCACAAUU
RS 2 dot ……………….((((((.(((((((((((….(((.((((((((((((.(((……))).)))))).))………..))))..)))….)))))…..))))))))))))………
RS 3 seq GAUGAAAACAUACACUCUAGCCUUGACGCCUGUGUCACAUGAUAUGGCGCCCUGGCCGUGGCGGUUUCGCCACCAGGGUACAGAAAGAAAUGACUGUGCCUCCCGUAUCUGGAAAGGUGUACAUGGCUUCACAAC
RS 3 dot ………………((((.((((((((…((.((.(((((((((((((((…(((((….))))))))))))………………)))….))))))))).)))))).)).))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table