Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA044278 Similarity: 0.919 Similarity: 0.915 Similarity: 0.912
UTR: 5HSAA044278
Gene: GLA_0
MFE: -71.240
ENS: 0.987
Length: 256.
Predicted Ligands:
cobalamin - 19/20
lysine - 1/20

 RS: URS0000C894B3_1188252
MFE: -72.221
Ligand: lysine
Species: Vibrio rumoiensis 1S-45 Lysine riboswitch
 RS: URS0002317360_1262865
MFE: -87.057
Ligand: cobalamin
Species: Coraliomargarita sp. CAG:312 Cobalamin riboswitch
 RS: URS0002327E6D_266265
MFE: -104.089
Ligand: cobalamin
Species: Burkholderia xenovorans LB400 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA044278 URS0000C894B3_1188252 URS0002317360_1262865 URS0002327E6D_266265
Length 256. 254. 257. 256.
Similarity - 0.919 0.915 0.912
Ensemble Norm 0.987 - - -
MFE -71.240 -72.221 -87.057 -104.089
Ligands - lysine cobalamin cobalamin
Gene GLA - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 12.013 24. 19.
Length SE - 4. 1. 0.
Lev Distance - 95. 98. 107.
UBS 15. 16. 15. 13.
BS 0. 0. 0. 3.
ILL 4. 2. 5. 4.
ILR 5. 6. 3. 3.
H 3. 4. 4. 3.
BL 7. 6. 4. 6.
BR 2. 4. 5. 3.
UN 0.152 0.039 0.163 0.141

Sequences

Field Description
UTR seq + 25 cuucugguauggaaauagggcgggucaauaucaagaaaggaagagggugauugguuagcggaacgucuuacgugacugauuauuggucuaccucuggggauaaccgucccaguugccagagaaacaauaacgucauuauuuaauaagucaucggugauugguccgccccugagguuaaucuuaaaagcccagguuacccgcggaaauuuaugcuguccggucaccgugacaATGCAGCTGAGGAACCCAGAACTAC
UTR dot + 25 .((((((((…..((.(((..(((…((((…..(((.(((.((((((((((((.((……….))))))))))))))..))).)))…..)))))))..))).))))))))))…………………….((((.(((((((((((((((.((((.((((………))))))))……)))))…………))))))))))))))…….(((…….)))……
RS 1 seq GUUUGAUGUAGAGGCGCGAUAUUUAUCAGUAGUUCAUAAGAGGGUGAUACCUAUGAUGAUGAAUGAAAGGGGAUAUCGCCGAAGUAGGUAUCGCUGGUAAAUAAUUCAGCUAAGCUUAUCAAGCUGCUUACUGGGGUUACGCCGAAUAGGUGUAACACUGCCAUAGUUUGUGCGAAUUUAUUUUUGAUGUUGUGGUUAAAUAUCAAACGAAUAGAUUGCGCAGUAUUUUUAUACUAUGGAGCGCUACUGUAGGC
RS 1 dot ((((((((.((.(((..(((((((((((((…………((((((((((.(.((…..)).)…))).)))))))…………)))))))))))..)).)))…))))))))))…….(((.((((((((…..)))))))).)))(((((((((((((.(((((((((((((((((…….))))))))..)))))))))))))))………)))))))…(((……)))
RS 2 seq AAUGUUCUUUUAUUUAUCGACACAAACAGCGCAAUACCGUGGAACGCCGUUAGAAUCGGCGACAGUCGCGCUGCGGUAACGGGGAACGUUCGGGACUUUUAUUAACGCGCUUUAUGCGCUGGCCAAUGAGCCGGUUUGUCGCGGAUUCAAUGCGCAUUGCAUCUGCAGGCGGACGGUUUGUGAAGGCGUUUCGGACGGCGCGGGCAUUGGGCCCGCAUAUUACCCGGAGUCCGAAUAUUCGGUGUUGCUUGUAGGAA
RS 2 dot ((((((((((…((((((…….((((((…((.((….(((((…….))))))).)).)))))))))))).))))))))))…………….((((…..))))..(((.(((((((.(((((((((((((.((((….)))).)))))).))))))))))))))…)))..(((((((..(((((((…..))))))………)..)))))))………………….
RS 3 seq CUACACUGGCCGCACUCUGGUGCCCGCGUGCGCUUUUCAACGGCGCGCGCAGUUAAACGGGAAGCAGGGGGCGCGGUUCGCCAGAACGCGCCAACCUGCGCUGCCCCCGCAACGGUAAGCGACCGCAUUCGUCUGCAAGUCGAUCCUGACCGCGUGUUGAAAGUUCAACUCGCGAGUGUGCCACUGCGCGUCACGCGUGGGAAGGCGGGAUCGAGAGGUCGCCAGCCCGGAUACCGGCCAGAGGGAGAGGCACGUC
RS 3 dot …..(((((((…(((((.((..(((((((((…….))))))))).(((…((((..(((((.(((((.((((….)))))))))..)))))……)))).)))…..((((((.(………….(((((((((.(((((((.(((……….((((((((…)))).))))))))))))))…..)))))))))).))))))..)))))))…)))))))……………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table