Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA044314 Similarity: 0.988 Similarity: 0.986 Similarity: 0.983
UTR: 5HSAA044314
Gene: GLDN
MFE: -21.192
ENS: 0.899
Length: 74.
Predicted Ligands:
fluoride - 7/20
guanidine - 5/20
homocysteine - 4/20
 RS: URS00021EE067_12908
MFE: -34.275
Ligand: guanidine
Species: unclassified sequences guanidine-IV riboswitch
 RS: URS00021EDBD1_12908
MFE: -21.599
Ligand: guanidine
Species: unclassified sequences guanidine-IV riboswitch
 RS: URS0000C0DD1D_1403948
MFE: -22.115
Ligand: zmp-ztp
Species: Varibaculum cambriense DORA_20 ZMP/ZTP riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA044314 URS00021EE067_12908 URS00021EDBD1_12908 URS0000C0DD1D_1403948
Length 74. 74. 74. 74.
Similarity - 0.988 0.986 0.983
Ensemble Norm 0.899 - - -
MFE -21.192 -34.275 -21.599 -22.115
Ligands - guanidine guanidine zmp-ztp
Gene GLDN - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6. 10.002 4.002
Length SE - 0. 0. 0.
Lev Distance - 14. 16. 21.
UBS 5. 3. 3. 6.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 1.
ILR 1. 0. 0. 2.
H 1. 1. 1. 1.
BL 2. 2. 1. 1.
BR 3. 2. 1. 3.
UN 0.284 0.270 0.243 0.243

Sequences

Field Description
UTR seq + 25 accauuguguaugauucguuguugacugcagcaucacuagauccgagugATGGTGGACCTGTGCAACAGCACCA
UTR dot + 25 ……………..((((((((((.((.(((((((…….))))))).)).)…)).)))))))….
RS 1 seq UUCAGAUUACCGCCGGGUACGUUCAGACUAUUCCAGUAGGCCUUAGCAGGAAUAGUGUGGACGUGCCCUUUUUU
RS 1 dot …………..(((((((((((.((((((((.((……..)).)))))))).)))))))))))……
RS 2 seq AAAAAAUUACCGCCGGGUAGCGCUUUCUCAACUUCGUUAGGCCUUAGAAGAAGUGAGAAUAGCGUUAUUUUUUU
RS 2 dot …………..(((((((((((((((.(((((…………..)))))))))).))))))))))….
RS 3 seq GUAACCGUGACUGGCGUAGGUGGGAUACCACCGGGGAACAAGUGGUCAAUCAGUCGCUCGCCUGGGCUGAUUUG
RS 3 dot …………(((.(((((((((((((((..(….)..)))))……))).).)))))).)))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table