Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA044320 Similarity: 0.974 Similarity: 0.966 Similarity: 0.966
UTR: 5HSAA044320
Gene: GLE1
MFE: -32.395
ENS: 0.812
Length: 130.
Predicted Ligands:
cobalamin - 9/20
FMN - 4/20
SAM - 2/20
 RS: URS0002320FD2_1904640
MFE: -40.299
Ligand: cobalamin
Species: Betaproteobacteria bacterium GR16-43 Cobalamin riboswitch
 RS: URS0000AB5C04_497965
MFE: -28.481
Ligand: guanidine
Species: Cyanothece sp. PCC 7822 Guanidine-I riboswitch
 RS: URS0000C7DC04_1653480
MFE: -52.366
Ligand: TPP
Species: Alloactinosynnema sp. L-07 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA044320 URS0002320FD2_1904640 URS0000AB5C04_497965 URS0000C7DC04_1653480
Length 130. 129. 131. 130.
Similarity - 0.974 0.966 0.966
Ensemble Norm 0.812 - - -
MFE -32.395 -40.299 -28.481 -52.366
Ligands - cobalamin guanidine TPP
Gene GLE1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4. 7.004 9.004
Length SE - 1. 1. 0.
Lev Distance - 32. 41. 42.
UBS 9. 10. 8. 10.
BS 0. 0. 0. 0.
ILL 4. 5. 4. 2.
ILR 2. 1. 3. 2.
H 1. 1. 1. 3.
BL 3. 3. 1. 3.
BR 3. 2. 2. 3.
UN 0.131 0.132 0.069 0.069

Sequences

Field Description
UTR seq + 25 gcgaccgaaaccuucucccuagccguuggcacguucugcucccgggaacccgugcagucuaacaaccugcauuuauuucuugacuucugcugguuguggugacucATGCCGTCTGAGGGTCGCTGCTGGG
UTR dot + 25 ……………..((((((….(((((.(((……(((…..((((.((((..((((((.(((…………….))).))))))…)))))))))))…))).)).)))))))))
RS 1 seq UUGAAAGUGUUUUAUCAUGGCCAUGCAACGGGAUGUUCGGGAAGCCGGUCCAAGUCCGGCACUGCCCCCGCAACGGUAGGCGAGCGUCGUCUCGCGAGUCCGGAGACCGGUCCAGUUAGCAACGCCGUC
RS 1 dot …………….(((((..((((((.((………..(((((((….(((((.(((…..(((….(.((((((…))))))))))))))))))))))))))).))).)))..))))).
RS 2 seq AAAAAAAGCUUCUAGGGUUCCGAUUUCCUGGAAAUGUCUGGUCCAAGAGAAGCGGGCUGCCUUAAAAGAAUUAUUGUUACAAGAUAAAUAUUUAGUAGGUGGCUACACGGCGGGAAAAAAACCCGGGAGGA
RS 2 dot ……..(((((.(((((….(((((((…….(((((…………((((((((((((….(((((…….)))))…))))..)))))))))).))))))))))..))))).))))).
RS 3 seq ACACCGCACCGCGGGAGCUCGCGCCAUGGCGGGCUGAGAGGGCGGCUGGUGUCCAUUCCUGGGACCCGGCGCCGCCGACCGAUGAACCUGACCGGGUAAUGCCGGCGUAGGGAGGAUUUUCGUGACCGCU
RS 3 dot …((((…)))).(((((((……)))))))…..(((((((((.((((.((((((.(..((((((..(((………………)))..))))))).))))))))))..))).).)))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table