Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA044336 Similarity: 0.987 Similarity: 0.985 Similarity: 0.985
UTR: 5HSAA044336
Gene: GLG1
MFE: -27.650
ENS: 0.946
Length: 75.
Predicted Ligands:
homocysteine - 6/20
SAM - 5/20
fluoride - 4/20
 RS: URS0000C46086_1736511
MFE: -24.492
Ligand: homocysteine
Species: Rhizobacter sp. Root29 S-adenosyl-L-homocysteine riboswitch
 RS: URS0000C84F15_1565605
MFE: -22.525
Ligand: homocysteine
Species: Rugosibacter aromaticivorans S-adenosyl-L-homocysteine riboswitch
 RS: URS0000BEB370_1452487
MFE: -16.281
Ligand: SAM
Species: Crenobacter luteus SAM riboswitch (alpha-proteobacteria)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA044336 URS0000C46086_1736511 URS0000C84F15_1565605 URS0000BEB370_1452487
Length 75. 75. 76. 76.
Similarity - 0.987 0.985 0.985
Ensemble Norm 0.946 - - -
MFE -27.650 -24.492 -22.525 -16.281
Ligands - homocysteine homocysteine SAM
Gene GLG1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.002 9.015 8.002
Length SE - 0. 1. 1.
Lev Distance - 17. 16. 17.
UBS 3. 4. 5. 5.
BS 0. 0. 0. 0.
ILL 0. 0. 1. 1.
ILR 1. 2. 3. 2.
H 1. 1. 1. 1.
BL 1. 1. 1. 0.
BR 1. 1. 1. 2.
UN 0.253 0.213 0.132 0.211

Sequences

Field Description
UTR seq + 25 auuuaaauacgcggcgccggcgagugcgucgagcucgccgcggacucaagATGGCGGCGTGTGGACGTGTACGGA
UTR dot + 25 …….((((((.(((((((((((…….)))))))………….)))).))))))…………
RS 1 seq CCCUCCAAGGAGCGUUGCGACGGGGGCCGAUCGGCCGCUGCCAGGCUUGGACGCUUGCAACCACGCUCACCCCCG
RS 1 dot ………((((((((((((((.((((….)))).)))…………..)))))…))))))…….
RS 2 seq GCUUCCGAGGAGCGCUGCAAGGCGAGGGUUCGAUCUCUCCCCAGGCUCGGUUUUUUGCAAACUGCGCUCACCUAAC
RS 2 dot ……(..(((((((((((((.(((((……))))).))…………)))))….))))))..)….
RS 3 seq UUCAAACCUCGCGCCGAUUUGGGACUGCUUGCGGGCGCGUUACAAAUACCAGCUAAAGUGUCGAGGGAGAAACCCG
RS 3 dot ……((((((((….(((((((((((….)))).)))…….))))…..))).)))))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table