Detected as a riboswitch by 5 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA044518 Similarity: 0.973 Similarity: 0.969 Similarity: 0.968
UTR: 5HSAA044518
Gene: GLT8D1
MFE: -45.889
ENS: 0.849
Length: 144.
Predicted Ligands:
TPP - 14/20
cobalamin - 4/20
FMN - 1/20
 RS: URS000232B030_393303
MFE: -59.021
Ligand: cobalamin
Species: Nocardioides sp. PD653 Cobalamin riboswitch
 RS: URS0000AB4820_1316932
MFE: -43.347
Ligand: TPP
Species: Mannheimia haemolytica M42548 TPP riboswitch (THI element)
 RS: URS0000C091A6_1736395
MFE: -51.523
Ligand: TPP
Species: Arthrobacter sp. Soil736 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA044518 URS000232B030_393303 URS0000AB4820_1316932 URS0000C091A6_1736395
Length 144. 143. 144. 144.
Similarity - 0.973 0.969 0.968
Ensemble Norm 0.849 - - -
MFE -45.889 -59.021 -43.347 -51.523
Ligands - cobalamin TPP TPP
Gene GLT8D1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.002 4. 4.011
Length SE - 1. 0. 0.
Lev Distance - 33. 40. 42.
UBS 10. 11. 9. 10.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 1.
ILR 4. 3. 3. 3.
H 2. 2. 2. 3.
BL 4. 5. 5. 5.
BR 3. 4. 2. 3.
UN 0.139 0.098 0.139 0.243

Sequences

Field Description
UTR seq + 25 cuuggcgcgacgcucuagcgguuaccgcugcgggcuggcugggcguaguggggcugcgcggcugccacggagcuagagggcaagguuaaaaacuaauauuuauaugacagaagaaaaagATGTCATTCCGTAAAGTAAACATCA
UTR dot + 25 .(((((….(.((((((((((..((((.((((.((.((((….)))).)).))))))))..)))…..))))))).)….)))))………(((((((((((………..))))))…)))))……….
RS 1 seq ACCGGCGUCCCCUAGGGUGGCCGCACGCGCGUCUCGUGGAACAGGAACCCGGUGAGAGUCCGGGGCGGUUCCGCCACUGUGACGCCGGUCCUCGUACCUGACGGCCGGCACAGCCAGACACUGGCCACGGGACAUUCACCCAA
RS 1 dot (((((((((…((((((((((((.((.((.((((.(((………)))..)))))).))..))))..))))).))).)))))))))….((.((((..((((((…………)))))).))))))……….
RS 2 seq CCGUUCUCAUUGGGGUGCAACAAGCGGUUGUUUUUGCGUAAAAAUUUGCAAAUUUUUGCCGAAAUUUAACCGCUUGUGGCUGAGAAAUACCCAUAGAACCUGAUCUGAUUAAUAUCAGCGUAGGGAUUUGAGAUAGCAACUUGC
RS 2 dot …((((((…….((.(((((((((((.(((((.(((((((((….))))))))))))))..))))))))))).))))))))…..(.((((.((((..(((((….)))))..))))..)))).)…………
RS 3 seq UUAUUACGACAGGGGAGCGCCGCCGUCGGGGAUCACUGGCAACUGCCAGCCGAACCUUGGAUGGGCGCUGAGAGUGCGGACAGCCGCAGACCCUCGAACCUGAUCCGGCUAGUACCGGCGUAAGGGAGUCGAGUUCUCAAAGUG
RS 3 dot ……………((((((.(..((((((.((.(((((….)))))..)).))))))..)))))))…..(((((….)))))….(((((.(((.((((((……)))).)).)))…)))))………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table