Detected as a riboswitch by 6 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA045135 Similarity: 0.976 Similarity: 0.969 Similarity: 0.969
UTR: 5HSAA045135
Gene: GNAT2
MFE: -33.833
ENS: 0.851
Length: 120.
Predicted Ligands:
SAM - 7/20
glycine - 4/20
FMN - 4/20
 RS: URS0000ABD094_658088
MFE: -18.466
Ligand: glycine
Species: Lachnospiraceae bacterium 9_1_43BFAA Glycine riboswitch
 RS: URS0002330064_1184609
MFE: -55.319
Ligand: cobalamin
Species: Kineosphaera limosa NBRC 100340 Cobalamin riboswitch
 RS: URS0000AB7767_386043
MFE: -28.601
Ligand: FMN
Species: Listeria welshimeri serovar 6b str. SLCC5334 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA045135 URS0000ABD094_658088 URS0002330064_1184609 URS0000AB7767_386043
Length 120. 120. 120. 121.
Similarity - 0.976 0.969 0.969
Ensemble Norm 0.851 - - -
MFE -33.833 -18.466 -55.319 -28.601
Ligands - glycine cobalamin FMN
Gene GNAT2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.001 4. 2.005
Length SE - 0. 0. 1.
Lev Distance - 31. 40. 40.
UBS 7. 8. 8. 8.
BS 0. 0. 0. 0.
ILL 3. 4. 3. 2.
ILR 1. 2. 1. 1.
H 3. 3. 2. 3.
BL 1. 1. 2. 1.
BR 2. 3. 3. 2.
UN 0.117 0.142 0. 0.190

Sequences

Field Description
UTR seq + 25 gucggacucccgcggccggacugugggggagucacgcaacaggaaaccuuacgagagaggauuaggggccugaaaaagcugacaagacggcaaauATGGGAAGTGGAGCCAGTGCTGAGG
UTR dot + 25 ……(((((((((…..))))))))).((((.((..((((…(((((………..))))).))))…..))))))….(((((….(((………))).)))))…
RS 1 seq AGCUCUCUGGAGAACGCGAGUAUGCGUACCGAAGAAGAAACUUAUGAAAUACGGAAGUUAAGAAUGAUAAUUGAAGUAAAACAUAAGGAAACUUUCAGGUUCGAGGACAGAGAUGAACAA
RS 1 dot …(((.(((…((((……)))).))).)))…..((((((…(((…(((((…….)))))…)))…))))))……((((..(((…….))).))))…
RS 2 seq CAUACUCGCGGGGUCAUUGUCGCCCGCGGGGUGCGGAAGCCGGUGUGAGUCCGGCACGGUCGCGCCACUGUGAGGACCCCUGUGGGUCCGAGUCAGACCCGGCUGCGCGGGAGACCCCUU
RS 2 dot …((((((((((…..(((.(.((((((((((((..(((((…….)))))….))))))).))))).))))))))))))))….(((…((((……)))).)))…..
RS 3 seq GUUCAUCUUCGGGGCAGGGUGCAAUUCCCGACCGGUGGUUAAAGUCCACGAUCUGCUUUUAGCAGUUGACUCUGGUGUAAUUCCAGGACCGACAGUAUAGUCUGGAUGGGAGAAGAUGUUG
RS 3 dot ……..((((((((…)))….)))))((((.((((((……….(((((…)))))))))))))))…..(((((…(((((……))).)).)))))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table