Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA045356 Similarity: 0.981 Similarity: 0.980 Similarity: 0.979
UTR: 5HSAA045356
Gene: GNL2
MFE: -27.331
ENS: 0.989
Length: 98.
Predicted Ligands:
purine - 13/20
TPP - 4/20
tetrahydrofolate - 2/20
 RS: URS0000AB5EAD_888832
MFE: -22.225
Ligand: purine
Species: Prevotella salivae DSM 15606 Purine riboswitch
 RS: URS0000ABBBC6_557436
MFE: -9.684
Ligand: purine
Species: Lactobacillus reuteri DSM 20016 Purine riboswitch
 RS: URS0000DB34F5_1214604
MFE: -29.579
Ligand: purine
Species: Tumebacillus algifaecis Purine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA045356 URS0000AB5EAD_888832 URS0000ABBBC6_557436 URS0000DB34F5_1214604
Length 98. 97. 99. 100.
Similarity - 0.981 0.980 0.979
Ensemble Norm 0.989 - - -
MFE -27.331 -22.225 -9.684 -29.579
Ligands - purine purine purine
Gene GNL2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.039 3.036 3.002
Length SE - 1. 1. 4.
Lev Distance - 24. 25. 22.
UBS 6. 6. 5. 7.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 2.
ILR 1. 2. 2. 2.
H 1. 1. 1. 1.
BL 2. 3. 2. 2.
BR 2. 2. 1. 2.
UN 0.102 0.299 0.293 0.060

Sequences

Field Description
UTR seq + 25 ggcuugguaacauaaaaguuuguuucaccacguaagccggaccucgcacuccggucccggucucgucgccaagATGGTGAAGCCCAAGTACAAAGGAC
UTR dot + 25 .((((((…………..(((((((((((.(.((((((((………))))).))).))))………))))))))))))))………
RS 1 seq UCCUUACCUUUGCCACGCUGUUAUAUAGGUCUGUAAUGGGUCAGACGUUUCUACCGGUUACCGUAAAUACCCGUCUAUAGCAGCUAUUUAUAAUGUA
RS 1 dot …………….(((((((((..((((.(((((.(((.(((….)))))).))))).)…..)))….)))))))))………….
RS 2 seq AACUACAUCAAAUAAAUAGCCUAUAUAAUACCGAAAUAUGGUCGGUUAGUCUCUACCUAAAGCCGUAAACUUUAGACUAUAAGCGCUUCUUAAAAACUG
RS 2 dot ……………..(((((.((((………((((((.(((……..)))….))))))……….)))))).)))…………
RS 3 seq AUGUCGAAAACAUAUAUGUCUCGUAUAUUUCCGGGGAUAUGGCCCGGUAGUCUCUACCAGUUCCCGGAAAGAACUGACUACGAGGACUCGACAUCGUGCA
RS 3 dot (((((((……….(((((((((.(((((((((((.(((…((….))…)))))))))))))).)……)))))).)))))))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table