Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA045360 Similarity: 0.954 Similarity: 0.946 Similarity: 0.945
UTR: 5HSAA045360
Gene: GNL2_0
MFE: -63.
ENS: 0.987
Length: 184.
Predicted Ligands:
cobalamin - 14/20
Mg2+ - 5/20
lysine - 1/20
 RS: URS00022C0DFC_137838
MFE: -51.060
Ligand: lysine
Species: Clostridium neonatale Lysine
 RS: URS00004553E9_266117
MFE: -81.261
Ligand: cobalamin
Species: Rubrobacter xylanophilus DSM 9941 Cobalamin riboswitch as predicted by Rfam
 RS: URS0002334256_411922
MFE: -42.586
Ligand: cobalamin
Species: Sporomusa sp. An4 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA045360 URS00022C0DFC_137838 URS00004553E9_266117 URS0002334256_411922
Length 184. 184. 183. 183.
Similarity - 0.954 0.946 0.945
Ensemble Norm 0.987 - - -
MFE -63. -51.060 -81.261 -42.586
Ligands - lysine cobalamin cobalamin
Gene GNL2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.006 26.001 15.
Length SE - 0. 1. 1.
Lev Distance - 61. 62. 68.
UBS 6. 5. 5. 8.
BS 7. 7. 10. 5.
ILL 0. 0. 1. 2.
ILR 1. 0. 2. 0.
H 4. 3. 3. 4.
BL 4. 4. 7. 3.
BR 3. 4. 1. 4.
UN 0.217 0.141 0.186 0.235

Sequences

Field Description
UTR seq + 25 gcucugaggccgagagggacgcgagcggaagugacguacgucgugcacacgugguccggcgugguucaggcgggugucuucggccgggcuugggaacauaaaaguuuguuucaccacguaagccggaccucgcacuccggucccggucucgucgccaagATGGTGAAGCCCAAGTACAAAGGAC
UTR dot + 25 …..((((((….(((((..(((.(…((((((…..))).))).((.(((((((((((((.(((((.(((…….)))..)))))((((((……..)))))))))))….)))))))).))).)))..))))))))))).((((((…))))))………………
RS 1 seq CUGUGAGGUAGAGGCGCAGAAUCCAACAGUCUUUAGCAGAGCUAGAGAGAGCAAUGAAGCUAUGGAGAAGGGGAUUUUGCCGAAGUUUGCAAUAUAUCUCAGUGUUGCUUGCUGGGUCUGUAGUUAAGAGCUGCAGGACUGUCUUAAUAAACUCCCCAGUUUAUUAAGUUGUGCUAUCUCAAUU
RS 1 dot …((((((…(((((((……((((((((((((..(((((.(((.(((((..(((((.(((.((((….)))).))).)))))(((((((……))))))))))))…))).)))))….)))).))))))))(((((((((((….))))))))))))))))))))))))…
RS 2 seq GUUAUCCUGCCCGGCGUAGGCGGGCGAGAGGUCCAGGAAGCCGGUGAGAGUCCGGCACGGUCCCGCCACUGUGACCGGGGAGCGACCCCCGCACGCAGGGCCACUGUCGCCGCGGGCGAUGGGAAGGCCGGGGGAAGCGGAGAUCCGGGAGUCAGGAUACUGGCCUCUCGCCGGAGAAACCCC
RS 2 dot …..(((((…..)))))(.(((((((((.((((….((..(((…((((((.((.((((.((.(((((..(((((……)))))..)))))((((.((((((((…))))))))…))))))))))..))..)..)))))..)))))…))))))))))))).)………
RS 3 seq UACAUAGUUAAAGGUACAGGUGCCCGCAAAGGCUUCAUAGAAAAGCCGGUAAAAGGCCGGCAUGGUCACGCCACUGUAACGGGGAGCAAUCUCGCAUAGUUGCCACUGAAGUAAAUCACUUUGGGAAGGAGCGGGAAAGCCAUGAACCGGAGUCAGGAGAACUGCCUAUUUGACAAUCAUCAU
RS 3 dot …………(((.(((((.(((((…..((((……..((((((…..)))))).(((.((….(((((..(((((…..))))).))))))))))(((((((…..)))))))))))..)))))…))).)).)))…((((((((……)).))))))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table