Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA045369 Similarity: 0.956 Similarity: 0.948 Similarity: 0.947
UTR: 5HSAA045369
Gene: GNL3
MFE: -64.821
ENS: 0.773
Length: 184.
Predicted Ligands:
cobalamin - 16/20
Mn2+ - 2/20
FMN - 1/20
 RS: URS0002314980_393303
MFE: -82.037
Ligand: cobalamin
Species: Nocardioides sp. PD653 Cobalamin riboswitch
 RS: URS0002323F31_1736540
MFE: -79.171
Ligand: cobalamin
Species: Aeromicrobium sp. Root472D3 Cobalamin riboswitch
 RS: URS000231A666_1089455
MFE: -78.086
Ligand: cobalamin
Species: Mobilicoccus pelagius NBRC 104925 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA045369 URS0002314980_393303 URS0002323F31_1736540 URS000231A666_1089455
Length 184. 185. 183. 183.
Similarity - 0.956 0.948 0.947
Ensemble Norm 0.773 - - -
MFE -64.821 -82.037 -79.171 -78.086
Ligands - cobalamin cobalamin cobalamin
Gene GNL3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10. 4.002 15.
Length SE - 1. 1. 1.
Lev Distance - 51. 66. 60.
UBS 17. 18. 18. 17.
BS 0. 0. 0. 0.
ILL 4. 4. 4. 5.
ILR 7. 6. 7. 7.
H 2. 2. 3. 3.
BL 7. 9. 6. 4.
BR 6. 8. 7. 4.
UN 0.049 0.059 0.093 0.038

Sequences

Field Description
UTR seq + 25 gcggccgccaagcgaucccugcuccgcgcgacacugcgugcccgcgcacgcagagaggcggugacgcacuuuacggcggcagcguaagugcgugacgcucgucaguggcuucaguucacacguggcgccagcggagaguuaaagaaagcaaguaaacgcATGACCTGCCATAAGCGGTATAAAA
UTR dot + 25 (((((((((……((.((((…(((((.(((…)))..)))))..)))).))))))))..)))….(((.(((((((.((..((((((.((((((.((..((((.(((((….)).))).))))..)).))))…………))..)))))).)))))))….)).)))…..
RS 1 seq AGUCAACCUCCCGUGGUCCGCCGCGGGGGCGCAGGGAACCCGGUGCGAAUCCGGGACUGACGCGCAGCGGUAAGGGUGACGGGCGGGGCCCUGUCUCACGACAGCCACUGGACCGCGAGGUCCGGGAAGGCGUCCCGCACCGAGUGAUCCCGAGUCCGAAGACCUGCUGGCCCUUGCGGCAACAG
RS 1 dot .((((…(((((.(((.(((..((((..(…..)..))))..))).)))))))).))))…..((.((((((((.((((((.((((.(.(..(((((((.(((.(((((((….)))))))…))))))………))))..).).))))…).)))).).)))))))).))…..
RS 2 seq UUAGGCUGCGGGCGAACCAGUCGUACCCAUUCGUUGGGUCAGGGAAUCCGGUGCGAAUCCGGAGCUGACGCGCAGCGGUGAGGGGGACGGAGGUGGCAUCGGCCACUGGAUCGCGAGAUCCGGGAAGGCGCCACCGUCCGGACGAACCCGAGUCCGAAGACCUGCUGGUUCGCGGUCGACACG
RS 2 dot ….((((((.(((..((.((((((((.((((.(((…))).))))..)))))))..).))..).).).))))))…..((((..((((((((((….(((.(((((((….)))))))…))))))))).))))..)…)))..(.(((..((((….))))..))).)……
RS 3 seq GUGCUUGGUAGGGUCGCCGGUGCCAGUCGCCCUCACGGGCCAGGGAACCCGGUGGAACUCCGGGACUGACGCGCAGCGGUGAGGCGGACGGGCGGGGCACGAGGCCACUGGGAGCACUCCUGGGAAGGCGCCCCGACCCGGAUGACGCCGAGUCCGAAGACCUGCUGGUGGUCGCCCGCGCAC
RS 3 dot ((.(((((.((..((((((((.((….((((….))))..)).)..)))))))..)))))))))……((((((((..((((..((((((((((…..(((.((((((….))))))…))))))))).))))…..))))..).)))…..))))((((((….)))).)).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table