Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA045391 Similarity: 0.933 Similarity: 0.932 Similarity: 0.931
UTR: 5HSAA045391
Gene: GNL3_0
MFE: -44.741
ENS: 0.868
Length: 214.
Predicted Ligands:
cobalamin - 14/20
lysine - 3/20
glycine - 1/20
 RS: URS0000D662D1_12908
MFE: -49.867
Ligand: glycine
Species: unclassified sequences glycine-GGAnGA riboswitch
 RS: URS0002322A29_85682
MFE: -54.086
Ligand: cobalamin
Species: Bacillus arseniciselenatis Cobalamin riboswitch
 RS: URS000232E33A_1235802
MFE: -53.907
Ligand: cobalamin
Species: Eubacterium plexicaudatum ASF492 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA045391 URS0000D662D1_12908 URS0002322A29_85682 URS000232E33A_1235802
Length 214. 216. 214. 213.
Similarity - 0.933 0.932 0.931
Ensemble Norm 0.868 - - -
MFE -44.741 -49.867 -54.086 -53.907
Ligands - glycine cobalamin cobalamin
Gene GNL3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6. 7.001 15.010
Length SE - 4. 0. 1.
Lev Distance - 80. 88. 83.
UBS 13. 12. 11. 14.
BS 0. 0. 0. 0.
ILL 4. 3. 3. 4.
ILR 5. 4. 4. 4.
H 4. 5. 4. 4.
BL 3. 2. 4. 5.
BR 2. 3. 2. 5.
UN 0.196 0.190 0.234 0.099

Sequences

Field Description
UTR seq + 25 gcagggaauuuugacuccauucuggaucuacugaauuuaauucucugggauuugaaaguagcacguauguuugcauuaggcauuucgcauuagacuuaacguuagguuugguagccaauaacacaagaaaaggauauaacuccauagugcguuaacccagaacuaaucauuuggguuaacagauuugugATGACCTGCCATAAGCGGTATAAAA
UTR dot + 25 ….(((……..)))….(((..(((((((((((((((((.((.((..((……(((……..)))……))..)).))..)))……)))))))))))))))))…………………….(((((..((((((((((((……..))))))))))).)..)))))…(((.((…..)))))……
RS 1 seq UCGGAUGAAUGCCGCUCUAGACACUGUAUGUGACAACAUUGUUUUUGAAAUAUAUACAGGGCCAAAGAAGCAAAACGGAAGGUGCAUAUCUCACCUUUUGUGGAAACUGCCAGGCAAAAGGAAGGCGACAGGACGAAUCUUUGGAGAGAAUGCUUUGGGCUUCCGCCCAGGAGCAUCACCUACGAGGCCAUAACCAACUGGUAAAAGGACAGAGAG
RS 1 dot ………….(((((…..(((((((((.(((……..)))…)))))))))……))).))…((((((((((…….))))))))))……((((…………))))………..(((((.((…(((((((((((….)))))).)))))…)).)))))((…(((….)))….))……..
RS 2 seq AUAUUUGACAAAUAGGUUGGGGUUGUUAUGCAAGUGUCUGACACUUGAUUUUGAUAGCCUCUGAAAAGGGAAGUUGGUGAAAUUCCAGCACGGUCCCGCCACUGUAAACGUUGAGGAAGGCAAAUGUUUCCACUGUGUAUAAAAAAUAUACAUGGGAAGGACUGCUAACUGUUGAAGCGUAAGUCAGGAGACCUGCCUAUUUUGUGUUUAAGCU
RS 2 dot ………………((((((((((..(((((((…)))))))….))))))))))……((((.(((((…….)))))….))))…………………((((..(.((((((.(((((((…..))))))))))))).)..))))….(((.(((((((((..(((…….)))..))))))))).))).
RS 3 seq GAAAUCACAGGAAACGUCUAUGAUAAUUGUUGGACUGUCAGGGGAAACAGGUGCAAAUCCUGUGCGAGCCCGUCGCCGUAAGGCAUAAAGUAAAGCUGCCGAUCGAACCAAAUGCCACAAGUUGGGAGAGAAAAGUCAUUGGAUGAUGCAAUCAUCUGAGAAGGCUGAUCGGCGGGAUGCCAAGCCGGAAUAUCCGGACAGAUUCGUCCCCGU
RS 3 dot …((((.(((…..))).))))…((((..((.((.(.(((..(((((…….)))))…..))).).)).))..))))…………(((((((………………………..((((.(((((((((…)))))))))…)))))))))))((((((….((((((…))))).)…..))))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table